ID: 1140245861

View in Genome Browser
Species Human (GRCh38)
Location 16:73248665-73248687
Sequence GCACGTGCACGTGTGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140245860_1140245861 15 Left 1140245860 16:73248627-73248649 CCTGTATGTGGAGAATGTATGTG No data
Right 1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140245861 Original CRISPR GCACGTGCACGTGTGTGTTG TGG Intergenic
No off target data available for this crispr