ID: 1140246723

View in Genome Browser
Species Human (GRCh38)
Location 16:73256831-73256853
Sequence TCCTCTCCATCAAGTCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140246722_1140246723 -4 Left 1140246722 16:73256812-73256834 CCATTTCATTTGGTGAATCTCCT No data
Right 1140246723 16:73256831-73256853 TCCTCTCCATCAAGTCCTGTTGG No data
1140246721_1140246723 4 Left 1140246721 16:73256804-73256826 CCTTTGTACCATTTCATTTGGTG No data
Right 1140246723 16:73256831-73256853 TCCTCTCCATCAAGTCCTGTTGG No data
1140246720_1140246723 5 Left 1140246720 16:73256803-73256825 CCCTTTGTACCATTTCATTTGGT No data
Right 1140246723 16:73256831-73256853 TCCTCTCCATCAAGTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140246723 Original CRISPR TCCTCTCCATCAAGTCCTGT TGG Intergenic