ID: 1140260222

View in Genome Browser
Species Human (GRCh38)
Location 16:73371662-73371684
Sequence AGAGGCAGCTTCTGTGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140260215_1140260222 25 Left 1140260215 16:73371614-73371636 CCCCTCAGTCCATCTTGGTTTGC No data
Right 1140260222 16:73371662-73371684 AGAGGCAGCTTCTGTGGAACAGG No data
1140260217_1140260222 23 Left 1140260217 16:73371616-73371638 CCTCAGTCCATCTTGGTTTGCTG No data
Right 1140260222 16:73371662-73371684 AGAGGCAGCTTCTGTGGAACAGG No data
1140260218_1140260222 16 Left 1140260218 16:73371623-73371645 CCATCTTGGTTTGCTGTAGCAAG No data
Right 1140260222 16:73371662-73371684 AGAGGCAGCTTCTGTGGAACAGG No data
1140260216_1140260222 24 Left 1140260216 16:73371615-73371637 CCCTCAGTCCATCTTGGTTTGCT No data
Right 1140260222 16:73371662-73371684 AGAGGCAGCTTCTGTGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140260222 Original CRISPR AGAGGCAGCTTCTGTGGAAC AGG Intergenic
No off target data available for this crispr