ID: 1140261113

View in Genome Browser
Species Human (GRCh38)
Location 16:73380854-73380876
Sequence GACCCAGAGTTATATATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140261109_1140261113 1 Left 1140261109 16:73380830-73380852 CCCCATCTCTACAAGAGGAACTT No data
Right 1140261113 16:73380854-73380876 GACCCAGAGTTATATATTCCTGG No data
1140261106_1140261113 24 Left 1140261106 16:73380807-73380829 CCAGCCTGGGAAACACAGTGAGA 0: 159
1: 4736
2: 49957
3: 148004
4: 267240
Right 1140261113 16:73380854-73380876 GACCCAGAGTTATATATTCCTGG No data
1140261111_1140261113 -1 Left 1140261111 16:73380832-73380854 CCATCTCTACAAGAGGAACTTGG No data
Right 1140261113 16:73380854-73380876 GACCCAGAGTTATATATTCCTGG No data
1140261110_1140261113 0 Left 1140261110 16:73380831-73380853 CCCATCTCTACAAGAGGAACTTG No data
Right 1140261113 16:73380854-73380876 GACCCAGAGTTATATATTCCTGG No data
1140261107_1140261113 20 Left 1140261107 16:73380811-73380833 CCTGGGAAACACAGTGAGACCCC 0: 52
1: 1330
2: 10766
3: 60023
4: 182714
Right 1140261113 16:73380854-73380876 GACCCAGAGTTATATATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140261113 Original CRISPR GACCCAGAGTTATATATTCC TGG Intergenic
No off target data available for this crispr