ID: 1140265904

View in Genome Browser
Species Human (GRCh38)
Location 16:73420443-73420465
Sequence TGCAGGGAAGGCGGCGTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140265892_1140265904 30 Left 1140265892 16:73420390-73420412 CCCCTGCCCAGGGGACATCTGGC No data
Right 1140265904 16:73420443-73420465 TGCAGGGAAGGCGGCGTCGCTGG No data
1140265896_1140265904 23 Left 1140265896 16:73420397-73420419 CCAGGGGACATCTGGCAACGTCT No data
Right 1140265904 16:73420443-73420465 TGCAGGGAAGGCGGCGTCGCTGG No data
1140265894_1140265904 28 Left 1140265894 16:73420392-73420414 CCTGCCCAGGGGACATCTGGCAA No data
Right 1140265904 16:73420443-73420465 TGCAGGGAAGGCGGCGTCGCTGG No data
1140265893_1140265904 29 Left 1140265893 16:73420391-73420413 CCCTGCCCAGGGGACATCTGGCA No data
Right 1140265904 16:73420443-73420465 TGCAGGGAAGGCGGCGTCGCTGG No data
1140265895_1140265904 24 Left 1140265895 16:73420396-73420418 CCCAGGGGACATCTGGCAACGTC No data
Right 1140265904 16:73420443-73420465 TGCAGGGAAGGCGGCGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140265904 Original CRISPR TGCAGGGAAGGCGGCGTCGC TGG Intergenic
No off target data available for this crispr