ID: 1140272246

View in Genome Browser
Species Human (GRCh38)
Location 16:73477654-73477676
Sequence CTCTGCACTGGTAGCCGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140272232_1140272246 27 Left 1140272232 16:73477604-73477626 CCCTGCCAACAGGCATCATGGTG No data
Right 1140272246 16:73477654-73477676 CTCTGCACTGGTAGCCGGTAGGG No data
1140272233_1140272246 26 Left 1140272233 16:73477605-73477627 CCTGCCAACAGGCATCATGGTGG No data
Right 1140272246 16:73477654-73477676 CTCTGCACTGGTAGCCGGTAGGG No data
1140272235_1140272246 22 Left 1140272235 16:73477609-73477631 CCAACAGGCATCATGGTGGCAGG No data
Right 1140272246 16:73477654-73477676 CTCTGCACTGGTAGCCGGTAGGG No data
1140272239_1140272246 -8 Left 1140272239 16:73477639-73477661 CCACGGGCCCCAGCACTCTGCAC No data
Right 1140272246 16:73477654-73477676 CTCTGCACTGGTAGCCGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140272246 Original CRISPR CTCTGCACTGGTAGCCGGTA GGG Intergenic
No off target data available for this crispr