ID: 1140279571

View in Genome Browser
Species Human (GRCh38)
Location 16:73542378-73542400
Sequence TTGTATAAAAATAAGGACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140279571_1140279573 -10 Left 1140279571 16:73542378-73542400 CCAACGTCCTTATTTTTATACAA No data
Right 1140279573 16:73542391-73542413 TTTTATACAACTGAGCTAAATGG No data
1140279571_1140279575 24 Left 1140279571 16:73542378-73542400 CCAACGTCCTTATTTTTATACAA No data
Right 1140279575 16:73542425-73542447 TCCATTGTGACCACTTGAATTGG No data
1140279571_1140279577 27 Left 1140279571 16:73542378-73542400 CCAACGTCCTTATTTTTATACAA No data
Right 1140279577 16:73542428-73542450 ATTGTGACCACTTGAATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140279571 Original CRISPR TTGTATAAAAATAAGGACGT TGG (reversed) Intergenic
No off target data available for this crispr