ID: 1140283570

View in Genome Browser
Species Human (GRCh38)
Location 16:73578465-73578487
Sequence TTAAAGCCTCTGAGCAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140283570_1140283573 26 Left 1140283570 16:73578465-73578487 CCTAGTTTGCTCAGAGGCTTTAA No data
Right 1140283573 16:73578514-73578536 AAGAGGAGAATATAATATGCAGG No data
1140283570_1140283572 9 Left 1140283570 16:73578465-73578487 CCTAGTTTGCTCAGAGGCTTTAA No data
Right 1140283572 16:73578497-73578519 AGGCTTTATGATTCTGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140283570 Original CRISPR TTAAAGCCTCTGAGCAAACT AGG (reversed) Intergenic
No off target data available for this crispr