ID: 1140293299

View in Genome Browser
Species Human (GRCh38)
Location 16:73684657-73684679
Sequence AGGGGCACATGCAGATAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140293299_1140293301 -10 Left 1140293299 16:73684657-73684679 CCAGATTATCTGCATGTGCCCCT No data
Right 1140293301 16:73684670-73684692 ATGTGCCCCTGCAATCACAAGGG No data
1140293299_1140293306 17 Left 1140293299 16:73684657-73684679 CCAGATTATCTGCATGTGCCCCT No data
Right 1140293306 16:73684697-73684719 TTTTTTTTTTTTTTTTTTTTTGG No data
1140293299_1140293307 23 Left 1140293299 16:73684657-73684679 CCAGATTATCTGCATGTGCCCCT No data
Right 1140293307 16:73684703-73684725 TTTTTTTTTTTTTTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140293299 Original CRISPR AGGGGCACATGCAGATAATC TGG (reversed) Intergenic