ID: 1140293301

View in Genome Browser
Species Human (GRCh38)
Location 16:73684670-73684692
Sequence ATGTGCCCCTGCAATCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140293298_1140293301 -9 Left 1140293298 16:73684656-73684678 CCCAGATTATCTGCATGTGCCCC No data
Right 1140293301 16:73684670-73684692 ATGTGCCCCTGCAATCACAAGGG No data
1140293299_1140293301 -10 Left 1140293299 16:73684657-73684679 CCAGATTATCTGCATGTGCCCCT No data
Right 1140293301 16:73684670-73684692 ATGTGCCCCTGCAATCACAAGGG No data
1140293297_1140293301 11 Left 1140293297 16:73684636-73684658 CCTCAAAATAAAGAGATTATCCC No data
Right 1140293301 16:73684670-73684692 ATGTGCCCCTGCAATCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140293301 Original CRISPR ATGTGCCCCTGCAATCACAA GGG Intergenic