ID: 1140293304

View in Genome Browser
Species Human (GRCh38)
Location 16:73684677-73684699
Sequence AAAAGGACCCTTGTGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140293304_1140293306 -3 Left 1140293304 16:73684677-73684699 CCTGCAATCACAAGGGTCCTTTT No data
Right 1140293306 16:73684697-73684719 TTTTTTTTTTTTTTTTTTTTTGG No data
1140293304_1140293308 24 Left 1140293304 16:73684677-73684699 CCTGCAATCACAAGGGTCCTTTT No data
Right 1140293308 16:73684724-73684746 GGAGTCTTGCTCTGTCACCCAGG No data
1140293304_1140293307 3 Left 1140293304 16:73684677-73684699 CCTGCAATCACAAGGGTCCTTTT No data
Right 1140293307 16:73684703-73684725 TTTTTTTTTTTTTTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140293304 Original CRISPR AAAAGGACCCTTGTGATTGC AGG (reversed) Intergenic