ID: 1140293306

View in Genome Browser
Species Human (GRCh38)
Location 16:73684697-73684719
Sequence TTTTTTTTTTTTTTTTTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295059
Summary {0: 12750, 1: 14510, 2: 25740, 3: 52715, 4: 189344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140293302_1140293306 -1 Left 1140293302 16:73684675-73684697 CCCCTGCAATCACAAGGGTCCTT No data
Right 1140293306 16:73684697-73684719 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
1140293299_1140293306 17 Left 1140293299 16:73684657-73684679 CCAGATTATCTGCATGTGCCCCT No data
Right 1140293306 16:73684697-73684719 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
1140293304_1140293306 -3 Left 1140293304 16:73684677-73684699 CCTGCAATCACAAGGGTCCTTTT No data
Right 1140293306 16:73684697-73684719 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
1140293303_1140293306 -2 Left 1140293303 16:73684676-73684698 CCCTGCAATCACAAGGGTCCTTT No data
Right 1140293306 16:73684697-73684719 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344
1140293298_1140293306 18 Left 1140293298 16:73684656-73684678 CCCAGATTATCTGCATGTGCCCC No data
Right 1140293306 16:73684697-73684719 TTTTTTTTTTTTTTTTTTTTTGG 0: 12750
1: 14510
2: 25740
3: 52715
4: 189344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140293306 Original CRISPR TTTTTTTTTTTTTTTTTTTT TGG Intergenic
Too many off-targets to display for this crispr