ID: 1140293307

View in Genome Browser
Species Human (GRCh38)
Location 16:73684703-73684725
Sequence TTTTTTTTTTTTTTTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 448503
Summary {0: 2676, 1: 87395, 2: 67301, 3: 106475, 4: 184656}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140293298_1140293307 24 Left 1140293298 16:73684656-73684678 CCCAGATTATCTGCATGTGCCCC No data
Right 1140293307 16:73684703-73684725 TTTTTTTTTTTTTTTGGAGATGG 0: 2676
1: 87395
2: 67301
3: 106475
4: 184656
1140293303_1140293307 4 Left 1140293303 16:73684676-73684698 CCCTGCAATCACAAGGGTCCTTT No data
Right 1140293307 16:73684703-73684725 TTTTTTTTTTTTTTTGGAGATGG 0: 2676
1: 87395
2: 67301
3: 106475
4: 184656
1140293304_1140293307 3 Left 1140293304 16:73684677-73684699 CCTGCAATCACAAGGGTCCTTTT No data
Right 1140293307 16:73684703-73684725 TTTTTTTTTTTTTTTGGAGATGG 0: 2676
1: 87395
2: 67301
3: 106475
4: 184656
1140293299_1140293307 23 Left 1140293299 16:73684657-73684679 CCAGATTATCTGCATGTGCCCCT No data
Right 1140293307 16:73684703-73684725 TTTTTTTTTTTTTTTGGAGATGG 0: 2676
1: 87395
2: 67301
3: 106475
4: 184656
1140293302_1140293307 5 Left 1140293302 16:73684675-73684697 CCCCTGCAATCACAAGGGTCCTT No data
Right 1140293307 16:73684703-73684725 TTTTTTTTTTTTTTTGGAGATGG 0: 2676
1: 87395
2: 67301
3: 106475
4: 184656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140293307 Original CRISPR TTTTTTTTTTTTTTTGGAGA TGG Intergenic
Too many off-targets to display for this crispr