ID: 1140293308

View in Genome Browser
Species Human (GRCh38)
Location 16:73684724-73684746
Sequence GGAGTCTTGCTCTGTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421846
Summary {0: 11170, 1: 44232, 2: 101511, 3: 128684, 4: 136249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140293305_1140293308 7 Left 1140293305 16:73684694-73684716 CCTTTTTTTTTTTTTTTTTTTTT 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
Right 1140293308 16:73684724-73684746 GGAGTCTTGCTCTGTCACCCAGG 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
1140293302_1140293308 26 Left 1140293302 16:73684675-73684697 CCCCTGCAATCACAAGGGTCCTT No data
Right 1140293308 16:73684724-73684746 GGAGTCTTGCTCTGTCACCCAGG 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
1140293304_1140293308 24 Left 1140293304 16:73684677-73684699 CCTGCAATCACAAGGGTCCTTTT No data
Right 1140293308 16:73684724-73684746 GGAGTCTTGCTCTGTCACCCAGG 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249
1140293303_1140293308 25 Left 1140293303 16:73684676-73684698 CCCTGCAATCACAAGGGTCCTTT No data
Right 1140293308 16:73684724-73684746 GGAGTCTTGCTCTGTCACCCAGG 0: 11170
1: 44232
2: 101511
3: 128684
4: 136249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140293308 Original CRISPR GGAGTCTTGCTCTGTCACCC AGG Intergenic
Too many off-targets to display for this crispr