ID: 1140294006

View in Genome Browser
Species Human (GRCh38)
Location 16:73690251-73690273
Sequence CTGAGTCTGCAAATCTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140294006_1140294007 7 Left 1140294006 16:73690251-73690273 CCAAACTAGATTTGCAGACTCAG No data
Right 1140294007 16:73690281-73690303 CGTATCTTAGCATCCATGTACGG No data
1140294006_1140294009 9 Left 1140294006 16:73690251-73690273 CCAAACTAGATTTGCAGACTCAG No data
Right 1140294009 16:73690283-73690305 TATCTTAGCATCCATGTACGGGG No data
1140294006_1140294011 23 Left 1140294006 16:73690251-73690273 CCAAACTAGATTTGCAGACTCAG No data
Right 1140294011 16:73690297-73690319 TGTACGGGGCCTATGCATTCAGG No data
1140294006_1140294008 8 Left 1140294006 16:73690251-73690273 CCAAACTAGATTTGCAGACTCAG No data
Right 1140294008 16:73690282-73690304 GTATCTTAGCATCCATGTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140294006 Original CRISPR CTGAGTCTGCAAATCTAGTT TGG (reversed) Intergenic
No off target data available for this crispr