ID: 1140295084

View in Genome Browser
Species Human (GRCh38)
Location 16:73702162-73702184
Sequence GTGTGAACGGGGAGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140295084_1140295101 25 Left 1140295084 16:73702162-73702184 CCCCCCACCCTCCCCGTTCACAC No data
Right 1140295101 16:73702210-73702232 AAAGACTGCCATAGCAAAAGGGG No data
1140295084_1140295100 24 Left 1140295084 16:73702162-73702184 CCCCCCACCCTCCCCGTTCACAC No data
Right 1140295100 16:73702209-73702231 AAAAGACTGCCATAGCAAAAGGG No data
1140295084_1140295096 -4 Left 1140295084 16:73702162-73702184 CCCCCCACCCTCCCCGTTCACAC No data
Right 1140295096 16:73702181-73702203 ACACTCACTATGGGAGAATTTGG No data
1140295084_1140295102 28 Left 1140295084 16:73702162-73702184 CCCCCCACCCTCCCCGTTCACAC No data
Right 1140295102 16:73702213-73702235 GACTGCCATAGCAAAAGGGGAGG No data
1140295084_1140295099 23 Left 1140295084 16:73702162-73702184 CCCCCCACCCTCCCCGTTCACAC No data
Right 1140295099 16:73702208-73702230 CAAAAGACTGCCATAGCAAAAGG No data
1140295084_1140295098 0 Left 1140295084 16:73702162-73702184 CCCCCCACCCTCCCCGTTCACAC No data
Right 1140295098 16:73702185-73702207 TCACTATGGGAGAATTTGGGTGG No data
1140295084_1140295097 -3 Left 1140295084 16:73702162-73702184 CCCCCCACCCTCCCCGTTCACAC No data
Right 1140295097 16:73702182-73702204 CACTCACTATGGGAGAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140295084 Original CRISPR GTGTGAACGGGGAGGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr