ID: 1140297327

View in Genome Browser
Species Human (GRCh38)
Location 16:73721599-73721621
Sequence GCTGAAGAGCAGATGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140297327_1140297333 12 Left 1140297327 16:73721599-73721621 CCATGCACCATCTGCTCTTCAGC No data
Right 1140297333 16:73721634-73721656 GCAGGCAAGGAAGCGATGTTTGG No data
1140297327_1140297329 -6 Left 1140297327 16:73721599-73721621 CCATGCACCATCTGCTCTTCAGC No data
Right 1140297329 16:73721616-73721638 TTCAGCAGTCCCAAAGATGCAGG No data
1140297327_1140297334 26 Left 1140297327 16:73721599-73721621 CCATGCACCATCTGCTCTTCAGC No data
Right 1140297334 16:73721648-73721670 GATGTTTGGTTCTCCTGCTATGG No data
1140297327_1140297330 -1 Left 1140297327 16:73721599-73721621 CCATGCACCATCTGCTCTTCAGC No data
Right 1140297330 16:73721621-73721643 CAGTCCCAAAGATGCAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140297327 Original CRISPR GCTGAAGAGCAGATGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr