ID: 1140299167

View in Genome Browser
Species Human (GRCh38)
Location 16:73739546-73739568
Sequence GGAGCTCCATGGGCACACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140299161_1140299167 15 Left 1140299161 16:73739508-73739530 CCAAATTGAGAACTGATGCTGTA No data
Right 1140299167 16:73739546-73739568 GGAGCTCCATGGGCACACCTTGG No data
1140299159_1140299167 17 Left 1140299159 16:73739506-73739528 CCCCAAATTGAGAACTGATGCTG No data
Right 1140299167 16:73739546-73739568 GGAGCTCCATGGGCACACCTTGG No data
1140299160_1140299167 16 Left 1140299160 16:73739507-73739529 CCCAAATTGAGAACTGATGCTGT No data
Right 1140299167 16:73739546-73739568 GGAGCTCCATGGGCACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140299167 Original CRISPR GGAGCTCCATGGGCACACCT TGG Intergenic
No off target data available for this crispr