ID: 1140299722

View in Genome Browser
Species Human (GRCh38)
Location 16:73745251-73745273
Sequence CATATTATGAAACAACTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140299722_1140299723 7 Left 1140299722 16:73745251-73745273 CCTAGTAGTTGTTTCATAATATG No data
Right 1140299723 16:73745281-73745303 CTTCAGTGTCTCCTGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140299722 Original CRISPR CATATTATGAAACAACTACT AGG (reversed) Intergenic
No off target data available for this crispr