ID: 1140300585

View in Genome Browser
Species Human (GRCh38)
Location 16:73753476-73753498
Sequence GAGTGGGTTAAAGTAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140300585_1140300589 3 Left 1140300585 16:73753476-73753498 CCTCAATTTACTTTAACCCACTC No data
Right 1140300589 16:73753502-73753524 AATTTTCATGTAATTAAAAGTGG No data
1140300585_1140300592 14 Left 1140300585 16:73753476-73753498 CCTCAATTTACTTTAACCCACTC No data
Right 1140300592 16:73753513-73753535 AATTAAAAGTGGGTTTAAGTGGG No data
1140300585_1140300590 4 Left 1140300585 16:73753476-73753498 CCTCAATTTACTTTAACCCACTC No data
Right 1140300590 16:73753503-73753525 ATTTTCATGTAATTAAAAGTGGG No data
1140300585_1140300591 13 Left 1140300585 16:73753476-73753498 CCTCAATTTACTTTAACCCACTC No data
Right 1140300591 16:73753512-73753534 TAATTAAAAGTGGGTTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140300585 Original CRISPR GAGTGGGTTAAAGTAAATTG AGG (reversed) Intergenic
No off target data available for this crispr