ID: 1140301159

View in Genome Browser
Species Human (GRCh38)
Location 16:73758601-73758623
Sequence CTTTGCTAAGAGCTAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140301155_1140301159 3 Left 1140301155 16:73758575-73758597 CCAAAATTCAAGTATTTTAATTA No data
Right 1140301159 16:73758601-73758623 CTTTGCTAAGAGCTAGGGGAAGG No data
1140301152_1140301159 8 Left 1140301152 16:73758570-73758592 CCCACCCAAAATTCAAGTATTTT No data
Right 1140301159 16:73758601-73758623 CTTTGCTAAGAGCTAGGGGAAGG No data
1140301151_1140301159 29 Left 1140301151 16:73758549-73758571 CCATCTGGTTGTTGGGGATAGCC No data
Right 1140301159 16:73758601-73758623 CTTTGCTAAGAGCTAGGGGAAGG No data
1140301154_1140301159 4 Left 1140301154 16:73758574-73758596 CCCAAAATTCAAGTATTTTAATT No data
Right 1140301159 16:73758601-73758623 CTTTGCTAAGAGCTAGGGGAAGG No data
1140301153_1140301159 7 Left 1140301153 16:73758571-73758593 CCACCCAAAATTCAAGTATTTTA No data
Right 1140301159 16:73758601-73758623 CTTTGCTAAGAGCTAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140301159 Original CRISPR CTTTGCTAAGAGCTAGGGGA AGG Intergenic
No off target data available for this crispr