ID: 1140302667

View in Genome Browser
Species Human (GRCh38)
Location 16:73773390-73773412
Sequence CAGTGGAGATGGAGAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140302662_1140302667 18 Left 1140302662 16:73773349-73773371 CCCTTGTGCTACATTTTCCATTA No data
Right 1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG No data
1140302660_1140302667 23 Left 1140302660 16:73773344-73773366 CCCATCCCTTGTGCTACATTTTC No data
Right 1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG No data
1140302664_1140302667 1 Left 1140302664 16:73773366-73773388 CCATTATCATCAAACTGTTTGTA No data
Right 1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG No data
1140302659_1140302667 24 Left 1140302659 16:73773343-73773365 CCCCATCCCTTGTGCTACATTTT No data
Right 1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG No data
1140302663_1140302667 17 Left 1140302663 16:73773350-73773372 CCTTGTGCTACATTTTCCATTAT No data
Right 1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG No data
1140302661_1140302667 22 Left 1140302661 16:73773345-73773367 CCATCCCTTGTGCTACATTTTCC No data
Right 1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140302667 Original CRISPR CAGTGGAGATGGAGAACAGA TGG Intergenic
No off target data available for this crispr