ID: 1140304791

View in Genome Browser
Species Human (GRCh38)
Location 16:73792953-73792975
Sequence CGAACATTCTGGGAATGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140304791_1140304796 26 Left 1140304791 16:73792953-73792975 CCTGCACATTCCCAGAATGTTCG No data
Right 1140304796 16:73793002-73793024 GAAAGATGCTGCCTTTGTTTGGG No data
1140304791_1140304795 25 Left 1140304791 16:73792953-73792975 CCTGCACATTCCCAGAATGTTCG No data
Right 1140304795 16:73793001-73793023 AGAAAGATGCTGCCTTTGTTTGG No data
1140304791_1140304794 -7 Left 1140304791 16:73792953-73792975 CCTGCACATTCCCAGAATGTTCG No data
Right 1140304794 16:73792969-73792991 ATGTTCGCTTCTGACACAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140304791 Original CRISPR CGAACATTCTGGGAATGTGC AGG (reversed) Intergenic
No off target data available for this crispr