ID: 1140306423

View in Genome Browser
Species Human (GRCh38)
Location 16:73807116-73807138
Sequence CTCTTCTCGGGTGCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140306423_1140306430 8 Left 1140306423 16:73807116-73807138 CCAGCTGGAGCACCCGAGAAGAG No data
Right 1140306430 16:73807147-73807169 GACCGCTGGCATTTCAGCTGTGG No data
1140306423_1140306429 -6 Left 1140306423 16:73807116-73807138 CCAGCTGGAGCACCCGAGAAGAG No data
Right 1140306429 16:73807133-73807155 GAAGAGGCAGCAGGGACCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140306423 Original CRISPR CTCTTCTCGGGTGCTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr