ID: 1140307143

View in Genome Browser
Species Human (GRCh38)
Location 16:73813743-73813765
Sequence TCTGAGGTACAGGAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140307143_1140307154 20 Left 1140307143 16:73813743-73813765 CCCTCCTCTTCCTGTACCTCAGA No data
Right 1140307154 16:73813786-73813808 TCAAGAACTCCTTCCCGGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 73
1140307143_1140307153 15 Left 1140307143 16:73813743-73813765 CCCTCCTCTTCCTGTACCTCAGA No data
Right 1140307153 16:73813781-73813803 GATACTCAAGAACTCCTTCCCGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140307143 Original CRISPR TCTGAGGTACAGGAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr