ID: 1140312463

View in Genome Browser
Species Human (GRCh38)
Location 16:73862872-73862894
Sequence AGTTATCTCCAGAAGATTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140312461_1140312463 15 Left 1140312461 16:73862834-73862856 CCTGACGTGATACCTACACATCA No data
Right 1140312463 16:73862872-73862894 AGTTATCTCCAGAAGATTCGTGG No data
1140312460_1140312463 22 Left 1140312460 16:73862827-73862849 CCGTTAGCCTGACGTGATACCTA No data
Right 1140312463 16:73862872-73862894 AGTTATCTCCAGAAGATTCGTGG No data
1140312462_1140312463 3 Left 1140312462 16:73862846-73862868 CCTACACATCATACAACTTTAGA No data
Right 1140312463 16:73862872-73862894 AGTTATCTCCAGAAGATTCGTGG No data
1140312459_1140312463 23 Left 1140312459 16:73862826-73862848 CCCGTTAGCCTGACGTGATACCT No data
Right 1140312463 16:73862872-73862894 AGTTATCTCCAGAAGATTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140312463 Original CRISPR AGTTATCTCCAGAAGATTCG TGG Intergenic
No off target data available for this crispr