ID: 1140313225

View in Genome Browser
Species Human (GRCh38)
Location 16:73868826-73868848
Sequence TGACATAAAAATATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140313225_1140313227 9 Left 1140313225 16:73868826-73868848 CCAAGCTCCATATTTTTATGTCA No data
Right 1140313227 16:73868858-73868880 ATGATCAATTTATAATCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140313225 Original CRISPR TGACATAAAAATATGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr