ID: 1140319001

View in Genome Browser
Species Human (GRCh38)
Location 16:73929519-73929541
Sequence AGATATAAGCAGAAACTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140319001_1140319002 4 Left 1140319001 16:73929519-73929541 CCATAAAGTTTCTGCTTATATCT No data
Right 1140319002 16:73929546-73929568 CATATATTGAATTTCCTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140319001 Original CRISPR AGATATAAGCAGAAACTTTA TGG (reversed) Intergenic
No off target data available for this crispr