ID: 1140322527

View in Genome Browser
Species Human (GRCh38)
Location 16:73967038-73967060
Sequence GTCCCCCGGGACCCTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140322527_1140322532 9 Left 1140322527 16:73967038-73967060 CCACCACCAGGGTCCCGGGGGAC No data
Right 1140322532 16:73967070-73967092 TCTACATATCAAACAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140322527 Original CRISPR GTCCCCCGGGACCCTGGTGG TGG (reversed) Intergenic
No off target data available for this crispr