ID: 1140322532

View in Genome Browser
Species Human (GRCh38)
Location 16:73967070-73967092
Sequence TCTACATATCAAACAGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140322529_1140322532 3 Left 1140322529 16:73967044-73967066 CCAGGGTCCCGGGGGACTGAAAC No data
Right 1140322532 16:73967070-73967092 TCTACATATCAAACAGCAGTTGG No data
1140322526_1140322532 10 Left 1140322526 16:73967037-73967059 CCCACCACCAGGGTCCCGGGGGA No data
Right 1140322532 16:73967070-73967092 TCTACATATCAAACAGCAGTTGG No data
1140322531_1140322532 -5 Left 1140322531 16:73967052-73967074 CCGGGGGACTGAAACGTGTCTAC No data
Right 1140322532 16:73967070-73967092 TCTACATATCAAACAGCAGTTGG No data
1140322527_1140322532 9 Left 1140322527 16:73967038-73967060 CCACCACCAGGGTCCCGGGGGAC No data
Right 1140322532 16:73967070-73967092 TCTACATATCAAACAGCAGTTGG No data
1140322530_1140322532 -4 Left 1140322530 16:73967051-73967073 CCCGGGGGACTGAAACGTGTCTA No data
Right 1140322532 16:73967070-73967092 TCTACATATCAAACAGCAGTTGG No data
1140322528_1140322532 6 Left 1140322528 16:73967041-73967063 CCACCAGGGTCCCGGGGGACTGA No data
Right 1140322532 16:73967070-73967092 TCTACATATCAAACAGCAGTTGG No data
1140322519_1140322532 21 Left 1140322519 16:73967026-73967048 CCTGACTCAGTCCCACCACCAGG No data
Right 1140322532 16:73967070-73967092 TCTACATATCAAACAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140322532 Original CRISPR TCTACATATCAAACAGCAGT TGG Intergenic
No off target data available for this crispr