ID: 1140339979

View in Genome Browser
Species Human (GRCh38)
Location 16:74148317-74148339
Sequence CTGTGGGAGAGGCAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140339979_1140339985 -8 Left 1140339979 16:74148317-74148339 CCATCCACCTGCCTCTCCCACAG No data
Right 1140339985 16:74148332-74148354 TCCCACAGTGCTGGGATTACAGG 0: 2641
1: 295980
2: 261775
3: 149501
4: 132181
1140339979_1140339988 11 Left 1140339979 16:74148317-74148339 CCATCCACCTGCCTCTCCCACAG No data
Right 1140339988 16:74148351-74148373 CAGGCGTGAGCCACCATACCCGG 0: 403
1: 14778
2: 73248
3: 166251
4: 219148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140339979 Original CRISPR CTGTGGGAGAGGCAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr