ID: 1140342711

View in Genome Browser
Species Human (GRCh38)
Location 16:74180843-74180865
Sequence CTTGTTATGTAAACTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140342708_1140342711 14 Left 1140342708 16:74180806-74180828 CCTAAGTTTGTTAAGGTAAGTCT No data
Right 1140342711 16:74180843-74180865 CTTGTTATGTAAACTGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140342711 Original CRISPR CTTGTTATGTAAACTGTGCC AGG Intergenic
No off target data available for this crispr