ID: 1140354859

View in Genome Browser
Species Human (GRCh38)
Location 16:74296950-74296972
Sequence CCCCCTGGTGCTGCTCAGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140354853_1140354859 9 Left 1140354853 16:74296918-74296940 CCGGAGCTGGCAGTGCAGAAGGT 0: 1
1: 1
2: 1
3: 19
4: 254
Right 1140354859 16:74296950-74296972 CCCCCTGGTGCTGCTCAGTGTGG 0: 1
1: 0
2: 4
3: 26
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140354859 Original CRISPR CCCCCTGGTGCTGCTCAGTG TGG Exonic
900143906 1:1149889-1149911 CCCCATGGGGGTGCTGAGTGTGG + Intergenic
900400222 1:2469992-2470014 CACCCAGGTGCTGCTCTCTGGGG - Intronic
900989768 1:6092964-6092986 GCCCCAGGTTCTGCTCAGGGTGG + Intronic
900996665 1:6126650-6126672 CCTCCTGCTGCTGCTCATAGTGG + Exonic
902471138 1:16648112-16648134 CGCCCTGGTGCTTCACACTGCGG + Intergenic
903942539 1:26941697-26941719 CCCCCTGGCACTGAGCAGTGGGG + Intronic
904610458 1:31723198-31723220 TCCCCTAGTGCTGCTGAGGGAGG + Intergenic
904633822 1:31864189-31864211 GACCCTGGTGCTTCTCTGTGTGG - Intergenic
906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG + Intronic
906535486 1:46548812-46548834 CCCCATGGAGCTGCTCAGTCAGG + Intronic
907056350 1:51372299-51372321 CCTTCCGGTGCTGCTCAGTGTGG + Intronic
908341900 1:63189933-63189955 CCCCCTGGTGTTGTTCAATGTGG - Intergenic
909495448 1:76272580-76272602 CTCCTTGGTGCTGCTCTGAGTGG + Intronic
912372832 1:109187044-109187066 CGCACTGGTTCTGCTCAGTCTGG + Intronic
912641628 1:111351770-111351792 CCCAATTGTGTTGCTCAGTGTGG + Exonic
915164898 1:153942934-153942956 CTGCCTGGTGCTGCCCAGTAAGG - Exonic
915309779 1:155001218-155001240 CCCCCTGGCGCCGCCCATTGTGG + Intergenic
915313176 1:155014729-155014751 CCAGCTGGCGCTGCTCATTGAGG - Exonic
915428317 1:155845410-155845432 CCCCCAGGTACTGCTCAATGTGG + Intronic
918508197 1:185280879-185280901 CCCCCTGTTGCTTCTCAGTGTGG + Intronic
920703304 1:208233912-208233934 TTCCATGGTGCTGCGCAGTGTGG - Intronic
920825458 1:209420893-209420915 GGCCCTGGTGCTGCTCTGTGTGG - Intergenic
922452462 1:225747951-225747973 TCACCGTGTGCTGCTCAGTGTGG + Intergenic
922884965 1:229012325-229012347 CCTCCTGGGGCTGCTGACTGGGG + Intergenic
923069632 1:230550585-230550607 TTTGCTGGTGCTGCTCAGTGTGG - Intergenic
924883513 1:248188336-248188358 CCTCCTGCTTCTGCTCAGAGAGG - Intergenic
924910196 1:248502387-248502409 CCCACCGGTGCTTCACAGTGTGG + Intergenic
924913905 1:248545651-248545673 CCCACCGGTGCTTCACAGTGTGG - Intergenic
1065368104 10:24953856-24953878 CGCCCTGGTCCTGCTCAGCAGGG + Intergenic
1067170715 10:43903887-43903909 GTCCCTGCTGCTGCTCAGGGGGG - Intergenic
1069557368 10:69407023-69407045 CCACCTGGGGCTGGGCAGTGGGG + Intronic
1069564126 10:69451770-69451792 CTCCCTGGAGCGGCTAAGTGTGG - Intronic
1069618962 10:69824575-69824597 CCCACTGGTCCTGGGCAGTGAGG + Intronic
1069629791 10:69890507-69890529 CCCCCTGTCCCTGTTCAGTGGGG + Intronic
1069718040 10:70533117-70533139 CCCCATGGAGGTGCTCAGGGTGG + Intronic
1069867574 10:71513209-71513231 CTGCTTGGGGCTGCTCAGTGTGG + Intronic
1070333172 10:75432014-75432036 TCCGCTGGGCCTGCTCAGTGAGG - Intronic
1070809499 10:79290525-79290547 CCCCTGGCTGCTGCTCTGTGAGG - Intronic
1071495392 10:86164341-86164363 CTCCCTGGTGCTGCTGGGGGTGG - Intronic
1072671154 10:97430497-97430519 CCCCATAGTGCCGCTCATTGAGG - Exonic
1072745632 10:97937313-97937335 TCCCCTGTTCCTTCTCAGTGAGG + Intronic
1074108982 10:110409210-110409232 ACCCCTGGTGCTGGCCAGTATGG + Intergenic
1074528038 10:114278350-114278372 CCTCCTTGTGCTCCTCTGTGTGG - Intronic
1076351260 10:129816432-129816454 CACCCTGGTCCTGTCCAGTGGGG - Intergenic
1076380266 10:130020584-130020606 CTGCCCGGTGCTTCTCAGTGGGG - Intergenic
1076393378 10:130120492-130120514 CCACCTGGTGCTGGCCTGTGTGG + Intergenic
1076537807 10:131193918-131193940 CCCCCTGTGGGGGCTCAGTGAGG - Intronic
1076555854 10:131321037-131321059 ACCCCTGCTGCTGCTCCGAGGGG + Intergenic
1077390974 11:2300481-2300503 CCCGCTGGTGGGGCACAGTGAGG + Intronic
1078532755 11:12149663-12149685 CACGATGGTGCTGCTCACTGAGG + Intronic
1079108009 11:17586311-17586333 CATCCTGCTGCTGCTCAGTGAGG - Intronic
1081686587 11:45047390-45047412 CCCCCTGTTGCTCCCCAATGGGG + Intergenic
1082004127 11:47410319-47410341 CCTCATGGTGGGGCTCAGTGGGG + Exonic
1083686959 11:64382326-64382348 CCTCCTGCTGCAGCCCAGTGGGG + Intergenic
1084295229 11:68209039-68209061 CCCCCTTTTACTTCTCAGTGAGG + Intronic
1088721229 11:112593607-112593629 CCCCCTAGGGCAGCTCTGTGAGG - Intergenic
1091321143 11:134652836-134652858 TCCTCTGATGCTGCTCAGTGTGG + Intergenic
1091860447 12:3776758-3776780 CCCCCTTGTGCTGCTATGAGAGG - Intergenic
1092143976 12:6202069-6202091 CCCCCTGGAGCTGGTCACTGAGG + Intronic
1092532809 12:9359703-9359725 CCCCCGGGTTCTGCCCAGGGTGG + Intergenic
1096094494 12:48925368-48925390 GCTGCTGCTGCTGCTCAGTGCGG - Exonic
1096233288 12:49909510-49909532 CCTCCTGGGGCTGCGCAGGGAGG - Intergenic
1097314800 12:58160461-58160483 ACCCCTGCTGCTGCTTAATGCGG + Intergenic
1098544299 12:71694328-71694350 GCCACTGGTGGTGCTCTGTGTGG + Intronic
1100337063 12:93641307-93641329 CCCCATAGTGCCGCTCATTGAGG + Intergenic
1100390032 12:94140029-94140051 CCCCCTGGGGCAGCTGAGCGGGG + Intergenic
1100553822 12:95672562-95672584 CCCCATAGTGCCGCTCATTGAGG - Intronic
1101361400 12:104031036-104031058 CCCCATAGTGCCGCTCATTGAGG - Intronic
1102642542 12:114379682-114379704 AGCCCTGGAGCTGCTCAGCGCGG + Intronic
1104129380 12:125878333-125878355 CCTCCCAGTGATGCTCAGTGGGG - Intergenic
1104448680 12:128853036-128853058 GCCCCTGGTCCTGGTCACTGTGG + Intergenic
1105026651 12:132853493-132853515 CCCTCGGGTGCTGGGCAGTGGGG + Exonic
1105936706 13:25107218-25107240 CTCCCTGGTCCTCCACAGTGTGG - Intergenic
1107382835 13:39875701-39875723 CCTCCTGCTGCCGCACAGTGCGG + Intergenic
1112967438 13:105213700-105213722 GGCCCTGGTGCTGCTCACTCTGG - Intergenic
1113029948 13:105982358-105982380 CCCCCTGCTGCAGCTGACTGGGG + Intergenic
1113790069 13:113023554-113023576 CACCCTGGGTCTTCTCAGTGAGG + Intronic
1120160302 14:81138477-81138499 ACCCTTGGTGCTGCTGGGTGCGG - Intronic
1120897604 14:89547753-89547775 AGCCTTGGTGCTGGTCAGTGGGG - Intronic
1121336820 14:93082690-93082712 TCCCATGCTGCTGCTAAGTGAGG - Intronic
1122802124 14:104236682-104236704 ACTCCTGGTGCTGCCCTGTGTGG - Intergenic
1125546187 15:40507327-40507349 CCGCCTGCTGCTTCCCAGTGGGG + Intergenic
1125922300 15:43532251-43532273 CCCTCTGGTGCTTCACAGAGAGG + Intergenic
1127536356 15:59893415-59893437 CCTCCTCATTCTGCTCAGTGAGG - Intergenic
1129714278 15:77837945-77837967 CCCCCTGGAGCTGTGCAATGGGG - Intergenic
1130957454 15:88637709-88637731 CCCCGTGGTGCTCCTCAGACAGG - Intronic
1131511525 15:93051837-93051859 CCCCCTTGGGATGCTCAGGGAGG + Intronic
1132146768 15:99433807-99433829 CCCCCAGGTTCTGCTCAGCGGGG - Intergenic
1132407337 15:101551841-101551863 CCGCGTGGGGCTGCTCTGTGAGG - Intergenic
1133737959 16:8630011-8630033 CCCCCTGGCGCTGCTCATTTGGG + Intronic
1136396255 16:29994065-29994087 ACCACTGGTGCTGCCCAGTCTGG + Exonic
1137509864 16:49089732-49089754 CCACCTTGTGCAGCTCAGAGGGG + Intergenic
1138027031 16:53530206-53530228 ACAGCTGGTGCTGCTGAGTGAGG + Intergenic
1138329082 16:56198807-56198829 CCCCCTTCTGCTTCTCAGGGTGG - Intronic
1140354859 16:74296950-74296972 CCCCCTGGTGCTGCTCAGTGTGG + Exonic
1140442723 16:74999602-74999624 CCCCCTGCTGCTGAGAAGTGGGG + Exonic
1142541154 17:660604-660626 GCCCCTGGTGCTGCTGGGTGTGG + Intronic
1142541171 17:660651-660673 CCCCTGGGTGCTGCTGGGTGTGG + Intronic
1142541184 17:660698-660720 CCCCTGGGTGCTGCTGGGTGTGG + Intronic
1142709113 17:1714168-1714190 CCACCTCTTGCTGCTCAGCGAGG - Intergenic
1143380006 17:6490152-6490174 CCCCCAGGTGCTACTGAATGAGG - Intronic
1143632471 17:8147018-8147040 CCCCCTGGTTCTGCTCACTGTGG - Intronic
1143854408 17:9838150-9838172 CCCCTGGGAGCAGCTCAGTGAGG + Intronic
1144131451 17:12250955-12250977 CCACCTGGTGCTTCCCTGTGTGG - Intergenic
1144852046 17:18248805-18248827 CTTGGTGGTGCTGCTCAGTGTGG + Exonic
1145278874 17:21454237-21454259 TCCACTGGGGCTGGTCAGTGAGG + Intergenic
1147606613 17:41777296-41777318 CCCCCTGGGACTGCTATGTGGGG - Intronic
1147661142 17:42117722-42117744 CCCCATGGAGCTGGTCAATGAGG - Exonic
1149775442 17:59353392-59353414 ACCATTGGTGCTGCTGAGTGTGG - Exonic
1150549674 17:66197727-66197749 ATCCCCGGTGCTGCTCAGCGTGG + Intergenic
1150583917 17:66500365-66500387 CTCCCTGGTGCAGCACAGTTTGG - Intronic
1150588095 17:66536596-66536618 CCCCCTTCTGCAGCTCAGAGGGG - Intronic
1150712251 17:67541811-67541833 CCCATTGGTCCTGCTAAGTGAGG - Intronic
1151235934 17:72719858-72719880 GCCCCTTGTGCTGCTCATGGAGG + Intronic
1151789074 17:76292448-76292470 CCACCTGGTGCAGATCAGCGTGG - Exonic
1151876157 17:76869212-76869234 ACCCCTGGTGATGACCAGTGGGG + Intronic
1152671158 17:81607761-81607783 CCCACTGTTGCTTGTCAGTGGGG - Intronic
1152690999 17:81717604-81717626 CCCCCTGGGGCTCATAAGTGGGG + Intronic
1152926692 17:83090626-83090648 CCGGAGGGTGCTGCTCAGTGAGG + Intronic
1156150340 18:34234064-34234086 CCCGCTGGTCCTGGGCAGTGAGG + Intergenic
1156465185 18:37344237-37344259 CCCCATGGGGCAGGTCAGTGGGG - Intronic
1157568440 18:48696353-48696375 CCCCCTGTTGGTGCTGACTGGGG + Intronic
1157884954 18:51357924-51357946 AACCCTGGTGCTTCTCTGTGTGG + Intergenic
1158052585 18:53241398-53241420 TCCACAGGTGCTGCTCCGTGGGG - Intronic
1160610253 18:80078826-80078848 CCCCCTGGTGGGGTGCAGTGTGG - Intronic
1160686312 19:438569-438591 CCCCCAGCTCCTGCTCAGCGGGG + Intronic
1160821627 19:1061748-1061770 CCCACAGATGGTGCTCAGTGAGG - Intronic
1161066838 19:2242834-2242856 CTCCCAGGTGTTACTCAGTGAGG + Intronic
1161572018 19:5035998-5036020 CCCCCTTCTGCAGCTCTGTGGGG + Intronic
1161707078 19:5827265-5827287 CCCCCCAGTGCTGCCCAGAGAGG + Intronic
1162371644 19:10283587-10283609 CACCGTGGTGCTGCTCCGTGGGG + Exonic
1162386338 19:10362396-10362418 CCCCGTCCTGCTGCTCAATGGGG + Exonic
1162860008 19:13499424-13499446 CCCCCTGCGACTGGTCAGTGTGG - Intronic
1163152455 19:15423315-15423337 ACACCTGCTGCTACTCAGTGTGG + Intronic
1163451385 19:17379331-17379353 CTCCAGGGTGGTGCTCAGTGAGG + Intergenic
1164556927 19:29260330-29260352 CCCCATGGGGCTGCTCATGGAGG + Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166538686 19:43592024-43592046 CCCCCTGAGCCTGCCCAGTGAGG - Exonic
1202703533 1_KI270713v1_random:4907-4929 CGCCCTGGTGCTTCACACTGCGG + Intergenic
926066815 2:9847401-9847423 CTCCCTGGAGCTGAGCAGTGTGG + Intronic
926309158 2:11662087-11662109 CCGCCTGGAGCTGCTGAGTGAGG - Exonic
926837249 2:17036752-17036774 GTTCCTGGTGCTGGTCAGTGAGG + Intergenic
927189330 2:20506353-20506375 CCCCCTGGTGCTGGTAAGGTTGG - Intergenic
927537187 2:23872730-23872752 CCCCATAGTGCTGCTCACTGAGG + Intronic
927884696 2:26711061-26711083 CCCCCTGGAGCCAGTCAGTGAGG - Intronic
928102059 2:28444507-28444529 TCCCCTGGCTCTGATCAGTGCGG + Intergenic
928163667 2:28952955-28952977 CCCACAGATGCTGCTCCGTGAGG - Intergenic
930032765 2:47068629-47068651 CCCCCAGCACCTGCTCAGTGGGG + Intronic
932306117 2:70705295-70705317 TTCCCTGGAGCTGCTCTGTGTGG + Intronic
932987878 2:76748658-76748680 CCCCATGGAGCTCCCCAGTGAGG + Exonic
935781981 2:106516221-106516243 CCCCCTGGTGCTGCTGGGAAAGG - Intergenic
935921386 2:108019200-108019222 ACACCTGGTGCTGCTAGGTGGGG - Intergenic
937212145 2:120281380-120281402 CCCCCGGGTGACTCTCAGTGAGG - Intronic
937671847 2:124546560-124546582 ACCCCTTGGGCTGCTCATTGTGG + Intronic
937872649 2:126797275-126797297 CGACATGGAGCTGCTCAGTGTGG - Intergenic
937908942 2:127066080-127066102 CCCCCTGGTGCAGCCTAGAGAGG + Intronic
938366404 2:130737882-130737904 ACCCTTGGTGCTGGCCAGTGAGG - Intergenic
942046221 2:172100860-172100882 CCCCAGGGTGCTGCTCCGAGGGG + Exonic
942455750 2:176137057-176137079 CCCCCTTGGGCAGCTCAGTCCGG + Intergenic
942918560 2:181343198-181343220 CCCCATGGTGCTGGGCAGAGTGG - Intergenic
944606808 2:201359081-201359103 CCCACTGCTGCTCCTCAGTCAGG - Intergenic
946064011 2:216970629-216970651 CCGACAGTTGCTGCTCAGTGGGG + Intergenic
946402793 2:219477336-219477358 CTCCCTGGTGGTGCTCAGCACGG + Exonic
947427009 2:229992937-229992959 CTCCATAGTGCTGCTAAGTGAGG + Intronic
948752622 2:240141303-240141325 CCTCCTGGTCCTGCTCCTTGGGG + Intronic
1168874400 20:1160881-1160903 GCACCTGGTGCTGCTGACTGAGG + Intronic
1171237525 20:23539523-23539545 CCCACTGGAGCTGCCCAGGGAGG + Intergenic
1172242927 20:33425329-33425351 AGCCCTGGGGCTTCTCAGTGTGG + Intronic
1173150506 20:40562897-40562919 CTCCCTGCAGCTGCTCAGAGAGG - Intergenic
1173157760 20:40629395-40629417 ACCTCAGGGGCTGCTCAGTGAGG + Intergenic
1175773266 20:61636888-61636910 GGCCCTGGTGCAGCTCAGGGAGG - Intronic
1176205485 20:63885899-63885921 CCCCCTGCTCGTGCTCAGTCAGG - Intronic
1176255006 20:64147109-64147131 GCCCCTTGGGCTGCTCTGTGGGG + Intergenic
1176258625 20:64167118-64167140 CTTCCTGGTGCTGCTCAGTCTGG + Intronic
1176268197 20:64221628-64221650 AGGCCTGGTGCTGCCCAGTGTGG - Intronic
1178162013 21:29928720-29928742 CCACATGGGGCTGCTCAGTCAGG + Intronic
1179160034 21:38887554-38887576 CCTCCTGGCCATGCTCAGTGGGG + Intergenic
1180130407 21:45823350-45823372 TCTCCTGGAGCTGCACAGTGTGG - Intronic
1180175275 21:46084196-46084218 CCCCCTAGTGCAGCTCTGGGGGG + Intergenic
1182554776 22:31123196-31123218 CTCCCTGGTGCTCCTGACTGAGG + Intronic
1183490526 22:38113285-38113307 CCCCCTGCTGGTGGTCACTGAGG + Intronic
1183830929 22:40418059-40418081 TGCCCTAGTGCTGCTCTGTGGGG - Intronic
949965032 3:9348697-9348719 CCCCAGAGTGCTGCTCATTGAGG - Intronic
950261526 3:11545797-11545819 CCCCCTGGCAGTGCTCAGTAAGG + Intronic
950543270 3:13624846-13624868 CCTCCTGGTGCTGCACCTTGTGG - Intronic
950562520 3:13742930-13742952 CCCCCTGGAGCTGTCCAGGGAGG + Intergenic
950566580 3:13773008-13773030 CCCCCTGGTCCTGCAGAATGCGG - Intergenic
950610776 3:14125291-14125313 CCGCCTGGAGCTCCTCCGTGCGG + Intronic
952828483 3:37543803-37543825 CCCTCAGATGCTTCTCAGTGGGG + Intronic
953827253 3:46264254-46264276 GCCCCTGGTGATGCTGAGTTAGG - Intronic
954144558 3:48628116-48628138 CCCCCTGGTGCTGGGCAGGTGGG + Intronic
954298294 3:49686126-49686148 CGCCCTGGTGCTTCACACTGCGG - Exonic
954644445 3:52122385-52122407 CCCCATGGAGCTGGCCAGTGTGG + Exonic
961374148 3:126451396-126451418 CATGCTGCTGCTGCTCAGTGCGG - Intronic
961439898 3:126946438-126946460 CCCCTGGCTGCTGCTTAGTGAGG - Intronic
961458632 3:127036620-127036642 CTCCCAGGTGCTGCACAGTTAGG - Exonic
963778867 3:149466641-149466663 CCCACTGGAGCAGCTCATTGTGG - Intergenic
966718484 3:183037451-183037473 CCCCCAGTTCCTGCTGAGTGGGG + Intronic
966992625 3:185249527-185249549 CCCCCTGCTGCTGTTCTGTGAGG + Intronic
968130433 3:196189894-196189916 CACCCTGTTTCTGCTCAGGGGGG - Intergenic
968222307 3:196948104-196948126 GGCCCTGGTGCTGCTCCCTGGGG - Exonic
968668865 4:1837165-1837187 CTCCTTGGTGCTGCTCACAGGGG + Intronic
969281727 4:6175131-6175153 CCCCCTGATGTTGGTCAGTTTGG - Intronic
969283065 4:6184429-6184451 CCTCCTTGTGATGCTGAGTGTGG - Intronic
969353167 4:6609912-6609934 CCCCCTGGAGCTGAACCGTGAGG + Exonic
970594177 4:17584747-17584769 CCCTCTGGTTCTGCTTTGTGTGG + Intronic
971301515 4:25446085-25446107 GCCCCTGTTGGTGTTCAGTGTGG + Intergenic
974920334 4:68231232-68231254 CCACCTGCTGCTGATCAGAGAGG + Exonic
975681859 4:76885320-76885342 CCCACCGGTGCTTCTCTGTGTGG + Intergenic
975704260 4:77096414-77096436 CTCCCTGCTGCTTCTCTGTGGGG - Intergenic
981306141 4:143248769-143248791 TCCCCTGGAGCTGTTCCGTGGGG - Intergenic
981430012 4:144646846-144646868 CCAGCTGGAGCTGCTGAGTGGGG + Exonic
984422524 4:179542856-179542878 CCCTCTGAAGCTGCTCAGGGAGG - Intergenic
985025206 4:185733471-185733493 CCACCTGGCTCTGCCCAGTGGGG - Intronic
985886761 5:2686206-2686228 CTCCTGGGTGCTGCTGAGTGTGG - Intergenic
987644114 5:20647654-20647676 GACCCTGGTCCTGCCCAGTGAGG - Intergenic
990157782 5:52898983-52899005 CCCCCAGGTGTTGCTCAGCTTGG - Intronic
991963990 5:72072975-72072997 CTTCCTGCTGCTGCTCAGGGTGG - Intergenic
992000612 5:72432550-72432572 CCCTCAGCTGCTGCTCAGTGGGG - Intergenic
992140361 5:73790500-73790522 TCCCCAGCTGCTGCTCAGTAGGG + Intronic
992613090 5:78524227-78524249 TTCCCTTGGGCTGCTCAGTGAGG + Intronic
993002383 5:82394474-82394496 CTTCCTTGTGCTGCCCAGTGTGG + Intergenic
998347351 5:141476458-141476480 CCCGCTGGAGCTGTTCAGCGTGG + Exonic
999098714 5:149004747-149004769 CCTCCGGGTGCTCCTCAGAGAGG - Exonic
999199526 5:149805963-149805985 GCCCCTGCTGCTGCACAGCGTGG - Intronic
1000303889 5:159978462-159978484 CTCCCTTGTGCTCCTAAGTGGGG + Intergenic
1002066414 5:176654271-176654293 CCCTGCGCTGCTGCTCAGTGAGG + Intronic
1002329998 5:178434651-178434673 GGCCCTGGTGCTGCTGAGGGAGG + Intronic
1002780157 6:359294-359316 CCCACAGGGGCTGCTCGGTGGGG + Intergenic
1006327028 6:33362057-33362079 CCCCCAGGAGGTGCTCAGTCAGG + Intergenic
1006796828 6:36737418-36737440 CACCCTCTTGCTGCTCTGTGGGG + Intergenic
1007094825 6:39206669-39206691 CTCCCCTGTGCTGCTCAGAGAGG - Intronic
1010178307 6:73055345-73055367 CCCCATAGTGCTGCTCATTGAGG - Intronic
1016981122 6:149855074-149855096 CACCCTGGTGCTGGGCATTGAGG - Intronic
1018050392 6:160004397-160004419 CCCTCACGTGCTGCTCAGTCAGG - Intronic
1018614550 6:165674434-165674456 CTCCCTGCTGATGCGCAGTGGGG + Intronic
1019215097 6:170438477-170438499 CCGCGTGGTGCTGGTGAGTGCGG - Intergenic
1019495756 7:1339825-1339847 CCCCCTGGAGCTGATCTGTCTGG - Intergenic
1019624541 7:2009325-2009347 CCCTCTGGTCCTCCTCAGTCCGG - Intronic
1019663370 7:2238547-2238569 CCCACTGGGGCTGCTCCGTCCGG - Intronic
1019863663 7:3684388-3684410 CCCCTTGCTGCTTCTCAGTGAGG - Intronic
1020069796 7:5219233-5219255 CCCTCTGTTGCTGCCCAGTTGGG - Intronic
1022569586 7:31438705-31438727 GCCCCTGTTGCTGCTGAGTGTGG + Intergenic
1022680047 7:32536250-32536272 CTCCCTGGAGCTGTGCAGTGAGG + Intronic
1024461654 7:49665941-49665963 ACCCCTTGTGCTTCCCAGTGAGG - Intergenic
1026247779 7:68636430-68636452 CCCCCTGGAGCTGCTCTGCCAGG - Intergenic
1026381059 7:69799791-69799813 CCTCCTGGTGCTGTTCCTTGAGG + Intronic
1027805886 7:82821774-82821796 CCCAATTGTGCTCCTCAGTGAGG + Intronic
1029495210 7:100892803-100892825 CCCCCAGGTGCTGGTGGGTGTGG - Exonic
1035320279 7:158024636-158024658 CCCCATGGGGCTGATCTGTGGGG + Intronic
1037969693 8:23163524-23163546 TCCTCTGGGGCAGCTCAGTGCGG + Intronic
1038114007 8:24532293-24532315 CCATCTGTAGCTGCTCAGTGAGG - Intergenic
1038428522 8:27481246-27481268 CTCCCTGGTGCTGCTCTGTGTGG - Intergenic
1040385394 8:46911853-46911875 CCCCCTGGTCCTGCACTGTGTGG - Intergenic
1041260736 8:56018934-56018956 CACCCTGGTGCTTCCCTGTGTGG - Intergenic
1045222657 8:100213584-100213606 TTCCCAGGTGCTGCTCACTGAGG - Intronic
1049023561 8:139973685-139973707 TTCCCTGGTGCTGCTCAGTGTGG - Intronic
1049056946 8:140244225-140244247 GCCCCTGGTGCTGCTGTGTGAGG + Intronic
1049204015 8:141355018-141355040 CTCTCGGGTGCTGCTCAGAGAGG - Intergenic
1049287974 8:141786888-141786910 CCGCCTGGTGCTGCTCTCGGGGG - Intergenic
1049438244 8:142597519-142597541 CCGCCTGGAGCTGATCAGTCAGG - Intergenic
1051582529 9:18693410-18693432 CCCACTGTGGCTGCTCAGTTTGG + Intronic
1053157945 9:35792993-35793015 ACACCTGGTGCTGCACACTGAGG - Exonic
1053354042 9:37431578-37431600 CACTGTGGTGCTTCTCAGTGGGG + Intronic
1055693118 9:78855632-78855654 CCCTCTAGTGCTGAGCAGTGTGG - Intergenic
1056558159 9:87706868-87706890 CCCCATGGTGTTGGTCAGTGAGG - Exonic
1061358555 9:130125063-130125085 CCACCTGGAGCTGAGCAGTGTGG + Intronic
1061956989 9:133968886-133968908 CCTCGTGGTGGTTCTCAGTGAGG - Intronic
1062043485 9:134414827-134414849 GCCCCGGGGGCTGCTCAGCGTGG + Intronic
1186893834 X:13986698-13986720 GCCCCTGTTGCTGCTAGGTGTGG - Intergenic
1187270422 X:17775520-17775542 CGCCCTGGAGGTGCTCAGTGAGG + Intergenic
1187320089 X:18230205-18230227 CGCCCTGGAGGTGCTCAGTGAGG - Intergenic
1189523958 X:41800239-41800261 GCCTCTGCTGCTACTCAGTGTGG - Intronic
1192358627 X:70424995-70425017 CCCCCGGCTGCTGCTCCGTCTGG + Exonic
1193135780 X:77969359-77969381 CCCCATAGTGCCGCTCATTGAGG + Exonic
1197902902 X:131392844-131392866 CTCCCTGGTGCTGCTCTGGGTGG - Intronic
1200175934 X:154116343-154116365 CCCCCTGGTGCTTCCCCATGGGG + Intergenic