ID: 1140354998

View in Genome Browser
Species Human (GRCh38)
Location 16:74297665-74297687
Sequence TAAATACGACCCTGGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 43}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140354998 Original CRISPR TAAATACGACCCTGGGGCCG GGG (reversed) Intronic
900480168 1:2894385-2894407 TGAAAACAACCCTGGGGCCCCGG - Intergenic
901701299 1:11045995-11046017 CAAAAACGACGCAGGGGCCGAGG - Intronic
914196943 1:145452490-145452512 TAAATTCTACCCCAGGGCCGTGG + Intergenic
924450273 1:244172401-244172423 TTAATACCACCCTGGAGCCTTGG - Intergenic
1064814720 10:19246570-19246592 TAAATAGGAGCCTGGGGCAGTGG + Intronic
1070930800 10:80259243-80259265 TAAATATGAACCTGGGGGCCAGG + Intergenic
1079367719 11:19823740-19823762 TAGTGACGTCCCTGGGGCCGGGG + Intronic
1093370125 12:18355582-18355604 CAAAGACTACCCTGGGGCCTGGG + Intronic
1096103481 12:48983154-48983176 TAAATACTGGCCTGGGGCAGTGG + Intergenic
1100272761 12:93042171-93042193 AAAATGCGAGCCTGGGGCGGTGG - Intergenic
1100548673 12:95626685-95626707 CAAATACTACCCTGGGGGTGGGG + Intergenic
1118896960 14:69953362-69953384 TGGATTCGACACTGGGGCCGAGG - Intronic
1129906446 15:79190991-79191013 CAACTGTGACCCTGGGGCCGAGG - Intergenic
1137063500 16:35812998-35813020 TAAATTCGACCCTGGAGGCATGG + Intergenic
1138207922 16:55138485-55138507 TAAACACGACCTTTGGGCCACGG + Intergenic
1140354957 16:74297440-74297462 AAGATACGACCCTGGGGTCGGGG - Intronic
1140354998 16:74297665-74297687 TAAATACGACCCTGGGGCCGGGG - Intronic
1140355024 16:74297803-74297825 TAGATACGACCCTGGGGGCGGGG - Intronic
1144854674 17:18261261-18261283 TGAAACCGGCCCTGGGGCCGTGG + Intronic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1150218728 17:63484192-63484214 GCAATAAGACCCTGGGGCCTGGG - Intergenic
1150431678 17:65123234-65123256 TAATGCCGACTCTGGGGCCGCGG - Intergenic
1158334598 18:56402135-56402157 TAAATAGGACTCAGGGTCCGGGG - Intergenic
1159642550 18:70880638-70880660 TAAATAAGTCCCTGGGCCCGAGG + Intergenic
929830728 2:45344379-45344401 TGAAGAAGACCCTGGGGCCCGGG - Intergenic
933073651 2:77894530-77894552 TAAATAGGAGGCTGGGGCTGAGG - Intergenic
940281386 2:151993330-151993352 GAAATAGGAGCCTGGGGCCCAGG + Intronic
948190095 2:236051687-236051709 TAAAAGCGACCCTGGGGGCAGGG + Intronic
1175596767 20:60240898-60240920 TAAATACAAACCTGAAGCCGGGG + Intergenic
1179605915 21:42514802-42514824 GAAATTCAAACCTGGGGCCGCGG - Intronic
950577674 3:13842474-13842496 TGAATAGGACTCTGGGGCAGGGG + Intronic
964862835 3:161221259-161221281 TTAATACGTCACTCGGGCCGCGG + Intronic
967976497 3:195037609-195037631 TAAAATCGACTCTGGGGCTGGGG - Intergenic
969493045 4:7510712-7510734 GAAATGCGACCCCGGGGCCTGGG + Intronic
976604053 4:86966026-86966048 TAACTACCACCCTGGGGAAGAGG - Intronic
985635449 5:1033527-1033549 GGAACACGTCCCTGGGGCCGGGG + Intronic
986758625 5:10859914-10859936 TAGAGCCGGCCCTGGGGCCGTGG - Intergenic
1012607651 6:101177899-101177921 CATATACCACCCTGGGGGCGGGG - Intergenic
1015880511 6:137866796-137866818 TAAAAACCACCCTGGCGCCCGGG - Intergenic
1016231009 6:141803964-141803986 TCAGTACGAACCTGGGGCCTGGG - Intergenic
1023601134 7:41882873-41882895 TAGATATGACCCTGGGGCCCTGG + Intergenic
1037139923 8:15507279-15507301 TAAAAAGGACCCTGAGGCCAAGG - Intronic
1044846117 8:96383529-96383551 TAAATTTGACACTGGAGCCGGGG - Intergenic
1050159015 9:2697774-2697796 AAAAAACGAACCTGGGGCCTGGG - Intergenic
1051322150 9:15916913-15916935 AAAATAAGCCCCTGGGGCCAAGG + Intronic
1052776604 9:32739242-32739264 TGAATATGAGCCTGGGGCTGGGG - Intergenic
1062361071 9:136188420-136188442 GAAACCCAACCCTGGGGCCGGGG + Intergenic
1062697791 9:137884352-137884374 TAAATTCTACCCCAGGGCCGTGG - Intronic
1186199156 X:7138665-7138687 GAAATACGAGACTGGGGCTGGGG - Intronic