ID: 1140357291

View in Genome Browser
Species Human (GRCh38)
Location 16:74317318-74317340
Sequence CTGTGTAAGTATGATTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140357289_1140357291 -6 Left 1140357289 16:74317301-74317323 CCTGCACACATTATATCCTGTGT No data
Right 1140357291 16:74317318-74317340 CTGTGTAAGTATGATTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140357291 Original CRISPR CTGTGTAAGTATGATTGTGA TGG Intergenic
No off target data available for this crispr