ID: 1140358025

View in Genome Browser
Species Human (GRCh38)
Location 16:74322389-74322411
Sequence GTATGCGAATGTAATACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140358025_1140358028 16 Left 1140358025 16:74322389-74322411 CCAATTGTATTACATTCGCATAC No data
Right 1140358028 16:74322428-74322450 CAGCATGTGACAGCTTACAAGGG No data
1140358025_1140358027 15 Left 1140358025 16:74322389-74322411 CCAATTGTATTACATTCGCATAC No data
Right 1140358027 16:74322427-74322449 CCAGCATGTGACAGCTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140358025 Original CRISPR GTATGCGAATGTAATACAAT TGG (reversed) Intergenic
No off target data available for this crispr