ID: 1140359169

View in Genome Browser
Species Human (GRCh38)
Location 16:74330300-74330322
Sequence ATGAATGGGCAAAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140359169_1140359177 18 Left 1140359169 16:74330300-74330322 CCCTCCACTTTTTGCCCATTCAT No data
Right 1140359177 16:74330341-74330363 CCAAACACCACGTGAGGTGTTGG No data
1140359169_1140359180 26 Left 1140359169 16:74330300-74330322 CCCTCCACTTTTTGCCCATTCAT No data
Right 1140359180 16:74330349-74330371 CACGTGAGGTGTTGGAGTTTGGG No data
1140359169_1140359175 12 Left 1140359169 16:74330300-74330322 CCCTCCACTTTTTGCCCATTCAT No data
Right 1140359175 16:74330335-74330357 TAAACACCAAACACCACGTGAGG No data
1140359169_1140359179 25 Left 1140359169 16:74330300-74330322 CCCTCCACTTTTTGCCCATTCAT No data
Right 1140359179 16:74330348-74330370 CCACGTGAGGTGTTGGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140359169 Original CRISPR ATGAATGGGCAAAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr