ID: 1140364150

View in Genome Browser
Species Human (GRCh38)
Location 16:74368362-74368384
Sequence GAGGGTGGCAAAGAGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140364150_1140364159 10 Left 1140364150 16:74368362-74368384 CCCGCGGCCTCTTTGCCACCCTC No data
Right 1140364159 16:74368395-74368417 TGTGGAAGCCTTGACTCTTAGGG No data
1140364150_1140364158 9 Left 1140364150 16:74368362-74368384 CCCGCGGCCTCTTTGCCACCCTC No data
Right 1140364158 16:74368394-74368416 CTGTGGAAGCCTTGACTCTTAGG No data
1140364150_1140364155 -8 Left 1140364150 16:74368362-74368384 CCCGCGGCCTCTTTGCCACCCTC No data
Right 1140364155 16:74368377-74368399 CCACCCTCAGAGGCGAGCTGTGG No data
1140364150_1140364162 27 Left 1140364150 16:74368362-74368384 CCCGCGGCCTCTTTGCCACCCTC No data
Right 1140364162 16:74368412-74368434 TTAGGGCCGTTTTAGAACCCGGG 0: 1
1: 1
2: 0
3: 2
4: 26
1140364150_1140364161 26 Left 1140364150 16:74368362-74368384 CCCGCGGCCTCTTTGCCACCCTC No data
Right 1140364161 16:74368411-74368433 CTTAGGGCCGTTTTAGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140364150 Original CRISPR GAGGGTGGCAAAGAGGCCGC GGG (reversed) Intergenic
No off target data available for this crispr