ID: 1140364881 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:74373664-74373686 |
| Sequence | GGTGATGAGCAGGAGGTGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1140364881_1140364887 | -10 | Left | 1140364881 | 16:74373664-74373686 | CCCTCCACCTCCTGCTCATCACC | No data | ||
| Right | 1140364887 | 16:74373677-74373699 | GCTCATCACCCAGCCTCAAAGGG | No data | ||||
| 1140364881_1140364892 | 21 | Left | 1140364881 | 16:74373664-74373686 | CCCTCCACCTCCTGCTCATCACC | No data | ||
| Right | 1140364892 | 16:74373708-74373730 | CTCAGTGCCTCTCCTCTGTTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1140364881 | Original CRISPR | GGTGATGAGCAGGAGGTGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||