ID: 1140364881

View in Genome Browser
Species Human (GRCh38)
Location 16:74373664-74373686
Sequence GGTGATGAGCAGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140364881_1140364887 -10 Left 1140364881 16:74373664-74373686 CCCTCCACCTCCTGCTCATCACC No data
Right 1140364887 16:74373677-74373699 GCTCATCACCCAGCCTCAAAGGG No data
1140364881_1140364892 21 Left 1140364881 16:74373664-74373686 CCCTCCACCTCCTGCTCATCACC No data
Right 1140364892 16:74373708-74373730 CTCAGTGCCTCTCCTCTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140364881 Original CRISPR GGTGATGAGCAGGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr