ID: 1140368524

View in Genome Browser
Species Human (GRCh38)
Location 16:74399456-74399478
Sequence GCGGCTGTTTATCCTTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140368524_1140368526 6 Left 1140368524 16:74399456-74399478 CCAGTCTAAGGATAAACAGCCGC No data
Right 1140368526 16:74399485-74399507 TCTCAGAGAAATTTGCACACTGG No data
1140368524_1140368527 9 Left 1140368524 16:74399456-74399478 CCAGTCTAAGGATAAACAGCCGC No data
Right 1140368527 16:74399488-74399510 CAGAGAAATTTGCACACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140368524 Original CRISPR GCGGCTGTTTATCCTTAGAC TGG (reversed) Intergenic
No off target data available for this crispr