ID: 1140372796

View in Genome Browser
Species Human (GRCh38)
Location 16:74422006-74422028
Sequence CCACGTGACTACAGGCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140372782_1140372796 -1 Left 1140372782 16:74421984-74422006 CCCCGGTGCCCACCACCCTCACC No data
Right 1140372796 16:74422006-74422028 CCACGTGACTACAGGCCAGGGGG No data
1140372786_1140372796 -10 Left 1140372786 16:74421993-74422015 CCACCACCCTCACCCACGTGACT No data
Right 1140372796 16:74422006-74422028 CCACGTGACTACAGGCCAGGGGG No data
1140372783_1140372796 -2 Left 1140372783 16:74421985-74422007 CCCGGTGCCCACCACCCTCACCC No data
Right 1140372796 16:74422006-74422028 CCACGTGACTACAGGCCAGGGGG No data
1140372784_1140372796 -3 Left 1140372784 16:74421986-74422008 CCGGTGCCCACCACCCTCACCCA 0: 3
1: 1
2: 4
3: 90
4: 769
Right 1140372796 16:74422006-74422028 CCACGTGACTACAGGCCAGGGGG No data
1140372780_1140372796 4 Left 1140372780 16:74421979-74422001 CCCAGCCCCGGTGCCCACCACCC No data
Right 1140372796 16:74422006-74422028 CCACGTGACTACAGGCCAGGGGG No data
1140372785_1140372796 -9 Left 1140372785 16:74421992-74422014 CCCACCACCCTCACCCACGTGAC No data
Right 1140372796 16:74422006-74422028 CCACGTGACTACAGGCCAGGGGG No data
1140372781_1140372796 3 Left 1140372781 16:74421980-74422002 CCAGCCCCGGTGCCCACCACCCT No data
Right 1140372796 16:74422006-74422028 CCACGTGACTACAGGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140372796 Original CRISPR CCACGTGACTACAGGCCAGG GGG Intergenic
No off target data available for this crispr