ID: 1140379890

View in Genome Browser
Species Human (GRCh38)
Location 16:74477128-74477150
Sequence TTTAATAAGCAACAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 353}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140379886_1140379890 -1 Left 1140379886 16:74477106-74477128 CCATACCATTGGCTCTAGAAGTT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG 0: 1
1: 0
2: 5
3: 29
4: 353
1140379887_1140379890 -6 Left 1140379887 16:74477111-74477133 CCATTGGCTCTAGAAGTTTTAAT 0: 1
1: 0
2: 1
3: 11
4: 212
Right 1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG 0: 1
1: 0
2: 5
3: 29
4: 353
1140379884_1140379890 14 Left 1140379884 16:74477091-74477113 CCTGTAAGAGGCAGGCCATACCA 0: 1
1: 0
2: 0
3: 10
4: 78
Right 1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG 0: 1
1: 0
2: 5
3: 29
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140379890 Original CRISPR TTTAATAAGCAACAGGAAGA GGG Intronic
902357868 1:15919935-15919957 ATCCATAAGCAACAGGAAAAGGG + Intronic
903317131 1:22516851-22516873 TATAGCAAGCAACTGGAAGAAGG + Intronic
904300441 1:29550292-29550314 TTCATGCAGCAACAGGAAGAAGG + Intergenic
904929256 1:34073309-34073331 TTTAATAATTAATAGGAAGTGGG - Intronic
906182723 1:43835746-43835768 TTTCATAAACAGCAGAAAGATGG - Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
907710055 1:56871981-56872003 TTAAATAAGCAACAGGGATCTGG - Intronic
908279159 1:62512427-62512449 ATTTATAAGGAAAAGGAAGATGG + Intronic
909808670 1:79904703-79904725 TTTTATTAGCAGCACGAAGACGG - Intergenic
909941197 1:81613994-81614016 TTTAATAATGATCTGGAAGAGGG - Intronic
910065513 1:83145940-83145962 TGGAGTGAGCAACAGGAAGAAGG + Intergenic
910596850 1:88990321-88990343 TAAAATGAGCAACAGGGAGATGG - Intronic
910682861 1:89885103-89885125 TTTAATAGGCAGCAGACAGATGG - Intronic
911201637 1:95050557-95050579 TTTAATCTGAACCAGGAAGAAGG + Intronic
911286855 1:96005484-96005506 ATAAATAAGTAAAAGGAAGATGG - Intergenic
913003158 1:114601968-114601990 TTTAAACAGCAAGAGGAAGGTGG - Intronic
914725751 1:150326160-150326182 GTTTATAAGTAACAGTAAGAAGG - Intronic
916817746 1:168370122-168370144 TTTAATAGCCAACAGGAATCTGG - Intergenic
916878314 1:168994121-168994143 TTTCATATGGAACAGAAAGAAGG - Intergenic
917530129 1:175827795-175827817 TTTAGTAAAGAATAGGAAGAAGG + Intergenic
917846542 1:179025462-179025484 TTAAAAAGGCAACAGGAGGAGGG + Intergenic
918115220 1:181490359-181490381 TTTAATAAGTAAGAGGATTAAGG - Intronic
918358843 1:183733991-183734013 TTTACTAAGCCAGAGGAAAATGG - Intronic
918781470 1:188705113-188705135 TGTTATAAGCAACAGTAAAATGG - Intergenic
919319746 1:196020899-196020921 TTTAATAGGCAAGAGAAAGAAGG + Intergenic
919571341 1:199252828-199252850 TTCATTTAGCAACATGAAGATGG - Intergenic
923411374 1:233713305-233713327 TTTTATCAGCAACATGAAAACGG + Intergenic
923942852 1:238847716-238847738 CTTAACAAACAACAGGAAGAAGG + Intergenic
924468970 1:244322926-244322948 TTTAAAAAGCAGTAGCAAGACGG + Intergenic
1062826986 10:577610-577632 TTAAATAAGCAGCAGGCTGATGG - Intronic
1063090048 10:2856973-2856995 TTTAATAAGAAAGAGAGAGAAGG + Intergenic
1063878146 10:10501941-10501963 TTGAAAAAGAAACAGGAATAGGG - Intergenic
1063896046 10:10683431-10683453 ATTAAAAAGAAACAGAAAGATGG - Intergenic
1063966569 10:11350859-11350881 TTTATTAAGCAACGTGCAGAAGG + Intergenic
1068116448 10:52741821-52741843 TCTCATAAGAAACAGGATGAAGG - Intergenic
1068903568 10:62297786-62297808 ATTAATAATTAACAGGGAGATGG - Intergenic
1069626505 10:69871154-69871176 GTTTAGAAGCAAGAGGAAGAGGG + Intronic
1071048548 10:81416444-81416466 TTAAAAAAGCAACATGAAGTGGG + Intergenic
1071179572 10:82967369-82967391 ATAAATAAGCAACGGGAGGAGGG - Intronic
1072080033 10:92020304-92020326 TTTTAAAAGCAACACCAAGAGGG - Intronic
1072945016 10:99801960-99801982 TTTAAAAATCAACTGGAGGAAGG - Intronic
1073660413 10:105469958-105469980 GCTAATAAGCAACAGAGAGATGG - Intergenic
1074614183 10:115049928-115049950 TTTAATAAATAACAGGAAGATGG + Intergenic
1075522643 10:123152865-123152887 TTAAATAAACAACTGGGAGAAGG + Intergenic
1075562425 10:123477976-123477998 TTTACTAAGAAAAAAGAAGACGG - Intergenic
1076160890 10:128243359-128243381 TTTCCTAGGAAACAGGAAGAAGG + Intergenic
1076452023 10:130562699-130562721 TTTAAAAAGCAACAAAAAGTTGG + Intergenic
1078902802 11:15656938-15656960 TTTATTATGCAATAGGAAAATGG - Intergenic
1079051885 11:17168016-17168038 TTTAAAAAAAAACAGGAATAAGG + Intronic
1079643308 11:22833164-22833186 TGTAATAAGGCACAGAAAGAGGG - Intergenic
1079743329 11:24092734-24092756 TATAAAAAGCAAAATGAAGAGGG + Intergenic
1079825209 11:25182163-25182185 TTTAATAATCAGAAGGAAGCAGG + Intergenic
1083834570 11:65257264-65257286 TGCCATCAGCAACAGGAAGAAGG + Intergenic
1084683077 11:70678432-70678454 TTTAATAAAGAACAGGCAGGAGG - Intronic
1085556415 11:77426612-77426634 TTCAATTAGCACCAGGCAGATGG + Intronic
1086105533 11:83142919-83142941 TTTAGAGAGAAACAGGAAGAGGG + Intergenic
1086232185 11:84583282-84583304 TTTTAAAAGCAACAGGGAGAGGG - Intronic
1087423547 11:97963542-97963564 TTTAATAAGCGAAAGGAAGAAGG + Intergenic
1087895655 11:103583035-103583057 TTTGACAAGCAACAGGGAGAAGG + Intergenic
1088067969 11:105744123-105744145 TATAATAAGGAACAGTCAGAGGG - Intronic
1088523116 11:110720756-110720778 TTTAACAAGAAACAGCAACAAGG + Intergenic
1088621846 11:111692976-111692998 TTTAATAAATAACAGAAACATGG + Intronic
1088666341 11:112097586-112097608 GTTAATAAGCTAGAGGTAGAAGG + Intronic
1088731205 11:112684600-112684622 TTTGATTAGCAAAAGGAGGAAGG + Intergenic
1089204032 11:116743962-116743984 TATAATATGCATCAGGAAGAAGG - Intergenic
1089726237 11:120482917-120482939 TAAAATAAGTAACATGAAGAGGG - Intronic
1091201546 11:133784517-133784539 TTTTATAACCAACAGGACAAGGG - Intergenic
1093818853 12:23586094-23586116 TTTAATAGGCAAAAGAAAGGAGG - Intronic
1094714231 12:32996128-32996150 TGTAATATGCAACATGATGATGG + Intergenic
1096213612 12:49785973-49785995 TTTAATAAAAAACAGAAAAAAGG - Intergenic
1096590736 12:52657590-52657612 TTTGAAAACCAACAGGAACAGGG + Intergenic
1097625430 12:61994373-61994395 TTGAAAAGGCAACAGGAGGAAGG - Intronic
1097782512 12:63724433-63724455 TTTATGAAGCAACAAGAACATGG + Intergenic
1097784674 12:63746058-63746080 TTTGATAAGTAACAGTATGATGG + Intergenic
1098169888 12:67736672-67736694 TGTGATAAGCCACAGGGAGAAGG + Intergenic
1098219009 12:68248700-68248722 TTTTTTAACCAAAAGGAAGATGG - Exonic
1098433813 12:70448398-70448420 GTTATCAAGAAACAGGAAGAGGG - Intergenic
1099453047 12:82831050-82831072 TGAAATAAGTAACAGGAAAATGG + Intronic
1100425386 12:94480023-94480045 TTTCATAACCAAAAGTAAGAAGG + Intergenic
1101797228 12:107986295-107986317 TTGAAGAAGCAACAGGGAGTTGG + Intergenic
1102653428 12:114460283-114460305 TTTAAAAAAAAAAAGGAAGAAGG + Intergenic
1103017146 12:117504019-117504041 TTTAAAAACCAACAGGCAAATGG + Intronic
1107985180 13:45769680-45769702 TATAAAAAGCAGCAGGCAGATGG - Intergenic
1109783547 13:67144257-67144279 TTTAAAATGAAAGAGGAAGAAGG + Intronic
1112765102 13:102733337-102733359 TTTGATAAGCCAAAGGAAGATGG - Exonic
1112968421 13:105228348-105228370 TTTATTCAGCAACCTGAAGATGG - Intergenic
1113219469 13:108083107-108083129 AGTAAAAAGCAAGAGGAAGATGG + Intergenic
1114320138 14:21540498-21540520 TTTAAAAAGCAACAGGAGCCGGG - Intergenic
1115040405 14:28917925-28917947 TTTAAGAAACAACAGGCAGCCGG - Intergenic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1117990977 14:61433193-61433215 TTGAATCAGAAACATGAAGAAGG + Intronic
1118787481 14:69058208-69058230 TTTAACATGTAACAGGAAGTTGG - Intronic
1119543752 14:75457279-75457301 TTCAAGAAGCACCAGGAAGGAGG + Intronic
1119717828 14:76871232-76871254 TTTAATAAGGAAGAGAAAGGGGG - Intergenic
1120564428 14:86037650-86037672 TATTATAAGCAACAGAAATATGG + Intergenic
1121901892 14:97700425-97700447 TTTATTAAGCACCAGCATGAAGG + Intergenic
1122386942 14:101355277-101355299 TTTCAAAAGCAACAAGAAGGTGG + Intergenic
1123795481 15:23766282-23766304 CTTTATCAGCAACATGAAGACGG + Intergenic
1124985812 15:34611624-34611646 TTTAGCAAGAAACAGGGAGAAGG + Intergenic
1125234218 15:37492821-37492843 TTTAAGAACAAACAGGAAAATGG + Intergenic
1125515946 15:40321372-40321394 TTTAATTTGCAACAGAAATATGG + Intergenic
1125630282 15:41141694-41141716 TTTAATAGGCAAGATGAAGGGGG - Intergenic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126322556 15:47440992-47441014 TTTCAAAGGCAAAAGGAAGAAGG - Intronic
1126402134 15:48282849-48282871 AATAATAAGCCACAGGAGGAAGG + Intronic
1126402569 15:48288117-48288139 TTTAAAAAGAAACAAGAAAAAGG + Exonic
1126464063 15:48944450-48944472 TTTTCCAAGCAGCAGGAAGAAGG - Intronic
1127300877 15:57652288-57652310 TTTAATAAGCATGAAGAAAATGG - Intronic
1132289349 15:100688632-100688654 CTCAATAGGCCACAGGAAGAGGG + Intergenic
1133626563 16:7575443-7575465 TTTAAGAAGAAAAAGGAAGAGGG + Intronic
1133713826 16:8427966-8427988 TTTAAAAAAAAAAAGGAAGAGGG + Intergenic
1135585496 16:23667664-23667686 TTTAATAGACAACAGGAATCTGG - Exonic
1137380845 16:47998205-47998227 TTTGATAAGTCACAGGAATATGG + Intergenic
1138103671 16:54274947-54274969 TTTAATATGCAACACGCAGCAGG + Intergenic
1138338244 16:56269615-56269637 TTTAATGATCCACAGGAAGCGGG - Intronic
1138691063 16:58769201-58769223 TCTTATAAGCAAGTGGAAGATGG + Intergenic
1138727196 16:59152707-59152729 TTTACAAAGAAAAAGGAAGATGG + Intergenic
1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG + Intronic
1141367718 16:83458654-83458676 TTTGCAAAACAACAGGAAGATGG - Intronic
1143561140 17:7695903-7695925 TTTAATGAGCAAAAGGAGGCAGG - Intronic
1146434372 17:32829748-32829770 TTTAAAAAACAACATGAAGCCGG - Intronic
1147301626 17:39533431-39533453 TTTAATAAAAAACAGGGAGTGGG - Exonic
1148717438 17:49725853-49725875 TTAAATAAGAAAGAGGCAGAGGG + Intronic
1149171591 17:53818651-53818673 TTTAATAAGCAGGGGAAAGATGG + Intergenic
1149333107 17:55606805-55606827 TTTAAGAAGCAGGAGGAAGGAGG - Intergenic
1150817403 17:68403493-68403515 TATTAGAAGCAAGAGGAAGAGGG - Intronic
1152320185 17:79604454-79604476 TTTAAAAAGCAATGGCAAGAAGG - Intergenic
1153547348 18:6221342-6221364 TTTAATAAGCAGCAATAAAAGGG + Intronic
1154237465 18:12619209-12619231 TTTAAAAATAAACAGCAAGAGGG + Intronic
1156146355 18:34185363-34185385 CTCACAAAGCAACAGGAAGAAGG + Intronic
1157049294 18:44142170-44142192 TCTAATAGGCAAAAGGAATAGGG - Intergenic
1158211266 18:55053220-55053242 TTAAACAAACAGCAGGAAGATGG - Intergenic
1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG + Intronic
1158619377 18:59018586-59018608 TTTATAGAGCAACATGAAGATGG - Intergenic
1158804320 18:60951397-60951419 TTTAATAATCAGAAGAAAGAAGG + Intergenic
1158844453 18:61426977-61426999 TTTAAGAAGCAACAGTATGAAGG + Intronic
1158956569 18:62546014-62546036 TATAATAAACCACAGGAAGATGG - Intronic
1160145891 18:76364045-76364067 TTCCAGAGGCAACAGGAAGACGG + Intronic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1162877179 19:13628981-13629003 TGTTATAAGCAACAGAAAGAGGG + Intergenic
1163525163 19:17816530-17816552 TTTACTAAGAGACAGCAAGAAGG + Exonic
1164226539 19:23250845-23250867 TTTAAAAAGAAACAAGAAAAAGG + Intergenic
1166586954 19:43957684-43957706 GTTAATTAGCAAGAGGAAAAAGG - Intronic
1167950618 19:53024251-53024273 TTTAAGAAGAAAGAGCAAGATGG - Intergenic
925980842 2:9175936-9175958 TGTTTCAAGCAACAGGAAGAAGG - Intergenic
927267530 2:21169105-21169127 TTAAAAAACCAACAGGAAAATGG - Intergenic
927304016 2:21549551-21549573 TTTAAAAAGAAACATGGAGAGGG + Intergenic
927527265 2:23756610-23756632 TTTAAGAAGCAGCAGAAAGAGGG - Intronic
928236502 2:29546483-29546505 TTCAATGAGAAACAGGAGGAAGG + Intronic
928492906 2:31802973-31802995 TTTCAAATGCAACAGGGAGAGGG - Intergenic
928541401 2:32287423-32287445 TTTAATAAGCAACAAGAGCAAGG - Intronic
928864152 2:35896624-35896646 TTTACTAAGAAACAGGAGAAAGG - Intergenic
929010873 2:37442942-37442964 TTTAATAAGAAATATGACGATGG + Intergenic
929626717 2:43416374-43416396 TTTAATAACCAAAAGGGAGCAGG + Intronic
929663983 2:43819254-43819276 TTTAAAAAGCAGCAGCAAAAAGG - Intronic
930452084 2:51554634-51554656 TTTCAAAAGCAGCAGGAAGGAGG + Intergenic
931973826 2:67620648-67620670 TTTAAGAATCTCCAGGAAGATGG + Intergenic
932524686 2:72451938-72451960 TTAAATGAGCAACAGGAATGTGG - Intronic
933240029 2:79909993-79910015 TTTAATATGGAACAGGTGGATGG + Intronic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933646314 2:84815450-84815472 TTAAATAAGAAAGAGGGAGAGGG - Intronic
936751811 2:115651463-115651485 TTTATTAAGCAATTAGAAGAAGG + Intronic
936861632 2:117027072-117027094 TGTAATAAGCAGGAGGAACAGGG - Intergenic
936963475 2:118101539-118101561 TTTACTCAGCAACAGGCAAAGGG + Intronic
937519570 2:122695647-122695669 TTTAAGAAGCAAAGTGAAGAAGG - Intergenic
937842465 2:126537559-126537581 TTTAAAAAGAAACAGAAAAAAGG + Intergenic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
939120986 2:138116180-138116202 TTCAACAAGCAATAGGAAAATGG - Intergenic
939183616 2:138833491-138833513 TTTCAAAAGATACAGGAAGAAGG + Intergenic
940268077 2:151861268-151861290 TTTGATAATCAAAATGAAGAGGG - Intronic
940381509 2:153019699-153019721 TTTGATAAGCAATAGGAACTTGG - Intergenic
941310074 2:163916807-163916829 TTGAATAAGCAAGAGTAACAGGG + Intergenic
941544716 2:166834461-166834483 TTCAATAAGAAACAGGGAAAAGG - Intergenic
943917958 2:193662157-193662179 TTTAATACGCATTAGTAAGATGG + Intergenic
944274575 2:197821437-197821459 TTTAATAAGCAACACTAAGCAGG + Intronic
944744270 2:202639531-202639553 TTTAATAAGTAAAATGAAGTTGG - Intronic
946913914 2:224495959-224495981 TTAAAAATGAAACAGGAAGATGG - Exonic
946955038 2:224920406-224920428 TAAAATAAGCAACTTGAAGAAGG - Intronic
947048074 2:226010688-226010710 TTTACTAAGCCACTGGAAAATGG + Intergenic
1168850087 20:970381-970403 AGTTATAAGCAACAGAAAGAGGG - Intronic
1169462955 20:5812389-5812411 CTTAACAGGCAACTGGAAGATGG + Intronic
1169936866 20:10893207-10893229 ATTACTCAGCAACAGCAAGAAGG + Intergenic
1170474290 20:16699635-16699657 TCTAATAACCAATAGGATGAAGG + Intergenic
1171364905 20:24617056-24617078 CTTAAGCAGCTACAGGAAGAGGG - Intronic
1173579761 20:44138689-44138711 TTTAATAAGCAACTGAGGGATGG + Intronic
1174215219 20:48911308-48911330 TTAGATAAGCCACAGGGAGAAGG - Intergenic
1174316519 20:49706995-49707017 TATAATAATCACCAGGAAGGAGG - Intronic
1175330442 20:58160169-58160191 TTTAAAAACCAAAAGGAAAATGG - Intronic
1175353449 20:58343208-58343230 TTGAACAAGGAGCAGGAAGATGG - Intronic
1175432604 20:58916810-58916832 TTTAATGAGGAAAAGGAAAAAGG + Intergenic
1175710918 20:61220290-61220312 AGTAATGAGCAACAGGAAGCAGG - Intergenic
1176664935 21:9677746-9677768 TGTTATAAGCAACAGAAAAATGG - Intergenic
1177049412 21:16213433-16213455 TTGATTAAGCAAGAGGAAAAAGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177220969 21:18192358-18192380 TTTTATAAGCATCATGAACAAGG + Intronic
1178085209 21:29105351-29105373 TGGAATGAGCAACAGGAAGAAGG - Intronic
1178294300 21:31395946-31395968 TTTAAAATTCAACAGGAACATGG + Intronic
1182392381 22:30009647-30009669 TTTAATAAGCAATAAGAATCAGG - Intronic
1182646437 22:31813621-31813643 CTCTAAAAGCAACAGGAAGAAGG - Intronic
1184566790 22:45296865-45296887 TTCCTTCAGCAACAGGAAGACGG - Intergenic
1184767705 22:46580183-46580205 TTTAGTGAGTAACAGGCAGAAGG + Intronic
1184926219 22:47641286-47641308 TTTTACCAGGAACAGGAAGATGG + Intergenic
949959633 3:9301376-9301398 GTTCAGAAGAAACAGGAAGAGGG + Intronic
951096330 3:18635335-18635357 GTTAACAAGAAATAGGAAGAAGG - Intergenic
951521440 3:23614604-23614626 TTTATTAAAAAAAAGGAAGAAGG - Intergenic
952330893 3:32363674-32363696 TATGATAAGCAACTAGAAGAAGG - Intronic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
953239351 3:41134839-41134861 TTTGAAAAGCAGCAGCAAGAAGG + Intergenic
953708701 3:45251239-45251261 TTTAAAAAGCAAAAGGAAGCAGG + Intergenic
954183500 3:48899504-48899526 TTTGAGAAACCACAGGAAGAGGG + Intergenic
957399860 3:79696335-79696357 TTTAATAAGCAACATAAAGTAGG - Intronic
959826896 3:110807961-110807983 TTTAATAAGAAAGAGTAAGGAGG + Intergenic
960072531 3:113447188-113447210 TTTTATCAGCAACATGAAAATGG + Intronic
960150080 3:114240330-114240352 TTTAATCAGCAAAATGAAAATGG - Intergenic
960456646 3:117880629-117880651 ATTTATAAACTACAGGAAGAAGG - Intergenic
962526273 3:136240590-136240612 TTTTCTAAGCAGCTGGAAGAGGG + Intergenic
964161172 3:153647356-153647378 GTAAATAAGCCACAGGAATAAGG + Intergenic
964353595 3:155828244-155828266 TTTAAAAAGTTACAGGATGAAGG - Exonic
966389100 3:179432835-179432857 TTTAATAAGAAACAGAAATCAGG + Intronic
966635635 3:182130142-182130164 TTTAATTAGTATCAGGTAGAGGG - Intergenic
968011492 3:195282015-195282037 TTCAAGAAGAAATAGGAAGAAGG + Intronic
968888231 4:3348490-3348512 TTTAATGAGACATAGGAAGAGGG + Intronic
969255909 4:6001663-6001685 TTTATTAAGTAAAAGGAGGAAGG - Intergenic
970015621 4:11509560-11509582 TTGACTAAGTAACAAGAAGAAGG + Intergenic
970940488 4:21627004-21627026 TTTAAGAGGCAATAGGAAAAAGG - Intronic
971238072 4:24861823-24861845 TGTAATAAGAAATGGGAAGATGG + Intronic
972559423 4:40213736-40213758 TTTAAAAAGGAACTAGAAGAAGG - Intronic
972602226 4:40582738-40582760 TTGAAGAAGAAACAGGTAGAGGG - Intronic
973194854 4:47427847-47427869 TTTAGAAAGCAAGAGGAAAAGGG + Intergenic
973898388 4:55440326-55440348 TTCAAAAAGCAAAAGGAAGCAGG - Intronic
974471283 4:62321590-62321612 TTTAATAATCAAAAGGCTGAAGG - Intergenic
975488986 4:74967838-74967860 ATTAATAAGCAACACATAGACGG + Intronic
976210927 4:82668992-82669014 TTAACTTAGCAACAGGTAGAGGG + Intronic
976315993 4:83659724-83659746 CTTAATAAGCAAGAGCAGGAAGG + Intergenic
976871288 4:89796720-89796742 TTTAACAAGGGACAGGAAAATGG - Intronic
977377846 4:96230092-96230114 TGTCATAAGGAACAGGAAGATGG + Intergenic
978389116 4:108206075-108206097 TTTAAAAAGAAAGTGGAAGAGGG - Intergenic
978389663 4:108212223-108212245 TTTTGTAAGCAACTTGAAGAGGG + Intergenic
978758550 4:112330403-112330425 ATTAATACACAACAGGGAGAGGG + Intronic
978828753 4:113056755-113056777 TTTAAAAAGCTGCAGGGAGAAGG + Intronic
979436572 4:120700178-120700200 AAAAATAAGCAACAGGAAAAGGG + Intronic
979569775 4:122207244-122207266 TCTACTAAACAACAGGAAAATGG + Exonic
979810298 4:125028422-125028444 TTTTATTAGCAGCAGGAAAATGG - Intergenic
980097094 4:128502262-128502284 TTAAATAAGTAAAAGGATGATGG - Intergenic
980195132 4:129578498-129578520 TGGAAAAAGCCACAGGAAGAAGG - Intergenic
982335721 4:154235411-154235433 TTTAATAAGTATCATGGAGAAGG - Exonic
982409917 4:155063030-155063052 ATCAATTAACAACAGGAAGAAGG + Intergenic
982498534 4:156123820-156123842 TTTAGAAATCAACAGAAAGATGG + Intergenic
982938483 4:161517619-161517641 TTATATAAGCAACAGCAATAAGG + Intronic
983327685 4:166279142-166279164 TATAATAAGTAACAGGAATTTGG + Intergenic
984529021 4:180892838-180892860 ATTAATAAGCAAAATGAATATGG + Intergenic
985305540 4:188535068-188535090 GTTAATATGCAACAGAAAGCAGG - Intergenic
985410407 4:189678188-189678210 TGTTATAAGCAACAGAAAAATGG - Intergenic
986618846 5:9648906-9648928 TGCAATGAGCAAAAGGAAGAGGG - Intronic
986678401 5:10210878-10210900 TTTAAAAAGAGAAAGGAAGAAGG + Intergenic
986962223 5:13228445-13228467 TTTAATAAACAACTGGATTAAGG - Intergenic
988466669 5:31498339-31498361 TTTTACAAGTAAAAGGAAGATGG - Intronic
988532202 5:32037670-32037692 TTCAATAAGCAGGAGAAAGATGG + Intronic
988946232 5:36203582-36203604 TTTAACAAGCAACATAGAGAAGG + Intronic
991684886 5:69172700-69172722 TTTAAAAAGCACTAGAAAGATGG - Intronic
992761515 5:79954956-79954978 CTTAACAAGCAACATGAAGAAGG + Intergenic
993851730 5:93018585-93018607 TTTCAGAAGCCACATGAAGATGG - Intergenic
994580905 5:101640721-101640743 TTGAATAAGAAACCAGAAGAGGG - Intergenic
994890411 5:105626517-105626539 ATTAAGAAGCCAGAGGAAGATGG - Intergenic
995371442 5:111423541-111423563 TTTTATAGGCAAGAGGTAGAAGG - Intronic
995954641 5:117761711-117761733 TCTAATAAGCAACAGGAGAAAGG - Intergenic
996631092 5:125633598-125633620 TTTAAAAAGAAAAAGAAAGAAGG + Intergenic
996809390 5:127498250-127498272 TTAAATAAGCAAGAGAGAGAGGG + Intergenic
997084266 5:130778491-130778513 TTTAAAAAGAAAAAGGAGGAAGG + Intergenic
1000384959 5:160666498-160666520 TTTAATAAGCCCCAAGGAGAAGG - Intronic
1000844462 5:166262061-166262083 TTTAAAGAGCAACAAGATGATGG - Intergenic
1001095198 5:168770705-168770727 TTAAAAAAGAAACAGGGAGAAGG - Intronic
1001485097 5:172114334-172114356 TTTAATAAGCAACATGACTTTGG - Intronic
1002653022 5:180717524-180717546 TTTAATAAGCCACATTAAAAAGG + Intergenic
1003657647 6:8028397-8028419 GTTAATATGCCACAGAAAGAAGG - Intronic
1003980938 6:11389230-11389252 TTTTGTAGGCAACAGGAAGTTGG - Intergenic
1005489126 6:26330526-26330548 GTTAATAAGAAATAGGAAAAAGG + Intergenic
1007850445 6:44797791-44797813 TTTAATTTGCAACAAGAAAAAGG + Intergenic
1008466591 6:51837977-51837999 TGAAATAAGCAACAGGGTGAAGG - Intronic
1009319161 6:62264791-62264813 TATAATAAGCAATAGGAAAAAGG - Intronic
1009901843 6:69816793-69816815 TTGAAAAGGCAACAGAAAGACGG - Intergenic
1010149364 6:72712317-72712339 TTTAAGAAGCCAGGGGAAGAAGG + Intronic
1010359708 6:74978436-74978458 CTTAATTTGCAACATGAAGATGG - Intergenic
1010949440 6:82017607-82017629 TTCAATAGGCAACAGGAGAAGGG + Intergenic
1011713387 6:90078316-90078338 TTAAATAAAAAACAGGGAGAAGG + Intronic
1012324257 6:97895380-97895402 TTTAATAAGCAAATGGAAGTGGG - Intergenic
1012667502 6:101992759-101992781 TTAAAAAATCAACAGGAAAAGGG + Intronic
1014043916 6:116861814-116861836 TGTAAAAACCAACAGGAAAAGGG - Intergenic
1014465398 6:121750364-121750386 TATAATAAGGAAGAGGAAAATGG + Intergenic
1014655054 6:124092446-124092468 TTTAAAAATCAACAGGAAGGAGG - Intronic
1014999639 6:128199383-128199405 ATTAATAAGTAACAGGTATATGG - Intronic
1015104204 6:129517538-129517560 TGTATTAAGCAACAGGACGGTGG - Intergenic
1015372247 6:132467216-132467238 TTTAATGAGCAAGAAGGAGATGG - Intronic
1015421824 6:133019648-133019670 TTCAATAAACATCTGGAAGAGGG - Intergenic
1015725839 6:136298489-136298511 TTTAATAAACAAGAAGAATAAGG + Intergenic
1016106701 6:140172150-140172172 CTTCATCAGCAACATGAAGATGG - Intergenic
1017037641 6:150280737-150280759 TTGAATGAGCACCAGGAGGAAGG + Intergenic
1017515845 6:155155095-155155117 TTCAATAGGCAATAGGGAGATGG + Intronic
1017868931 6:158469812-158469834 TTTAACAAGCAGCAGAAGGAAGG + Intronic
1018947234 6:168356403-168356425 TTTAAAAAGAAGCAGAAAGAAGG - Intergenic
1020473771 7:8570626-8570648 TTTGAGATTCAACAGGAAGAAGG + Intronic
1021384324 7:20009293-20009315 TTTAATAAGCATAAGACAGAAGG + Intergenic
1022459296 7:30589058-30589080 TTTTAAAGGCAACAGGGAGAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022941117 7:35240539-35240561 TTTATGAAGCAACAAGAACATGG + Intronic
1023088212 7:36593605-36593627 GTTAATAGGCACAAGGAAGATGG - Intronic
1024663149 7:51519172-51519194 TTTAACCAACAACAGGAAAACGG + Intergenic
1024838083 7:53548119-53548141 TTTAATAAGAAACATAATGAAGG - Intergenic
1026989956 7:74579315-74579337 TTTGAAAAGGAAGAGGAAGAAGG + Intronic
1027278597 7:76588813-76588835 TGGAGTGAGCAACAGGAAGAAGG - Intergenic
1028150658 7:87367672-87367694 TTGACTAAGCAAGAGGAAGCGGG - Intronic
1030222085 7:107107965-107107987 TTTAATAAGCAAAGTGTAGAAGG + Intronic
1030807017 7:113931259-113931281 TTTTATCAGCAACATGAAAATGG - Intronic
1031123761 7:117749714-117749736 TTTTTTAATCACCAGGAAGATGG + Intronic
1031303047 7:120088019-120088041 TTTAAGTAGCAAAAGGCAGAGGG - Intergenic
1032474235 7:132201552-132201574 ATTATGAAGCAGCAGGAAGAGGG - Intronic
1032480528 7:132242876-132242898 TTAAAGACGCAACAGAAAGAGGG - Intronic
1032986948 7:137347468-137347490 TTGCACAAGAAACAGGAAGAAGG - Intergenic
1033516442 7:142111357-142111379 TTTAATAAGTAAGTGAAAGAAGG - Intergenic
1034645796 7:152646096-152646118 TTTAAAATGAAACAGGAAAATGG - Intronic
1037229967 8:16646176-16646198 TTCCAGAAGCAAAAGGAAGAGGG + Intergenic
1037558767 8:20053800-20053822 TTATATTAGCAACAGGAAGAAGG - Intergenic
1038092092 8:24266215-24266237 TTTAAAAAGTAAGAGAAAGAAGG + Intergenic
1038986225 8:32813392-32813414 TTTAAATAGCAAAAAGAAGAAGG + Intergenic
1040636882 8:49285456-49285478 TTTAGTAAGCAATAAAAAGAAGG - Intergenic
1040739451 8:50555217-50555239 TTTAATATGCAACAGACATATGG - Intronic
1041022411 8:53651203-53651225 TTTAAAAAGCAAAAAGAAGCAGG + Intergenic
1041556330 8:59160536-59160558 AACAATAAGCAACAGGAAAATGG - Intergenic
1042607413 8:70559445-70559467 TTTAATAAACATCAGGCATAGGG + Intergenic
1043068156 8:75602783-75602805 TTTAATCATCATCAGGAAAATGG + Intergenic
1043887375 8:85617378-85617400 TTTAAAAAGTTACAGGATGAAGG - Intergenic
1044260959 8:90120253-90120275 TTTTAAAAGCAAAAGCAAGAGGG - Intergenic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1045663624 8:104464040-104464062 TTTAATATTCAACAGGAATTTGG + Intronic
1045782887 8:105888146-105888168 TTTAATAATTAACAGGGAAAAGG + Intergenic
1045812229 8:106235457-106235479 TTTAAAAACCTACCGGAAGAGGG + Intergenic
1045923721 8:107563858-107563880 TTAAATAAGCAATAGAAAAAGGG - Intergenic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1045959793 8:107953651-107953673 TTTCCTAAGCAGCAGGATGATGG + Intronic
1047034685 8:120924226-120924248 TTTTATAAGAAACTGGAACATGG - Intergenic
1047184864 8:122623796-122623818 TCCAATAAGGAACAGGAACAAGG - Intergenic
1047742478 8:127817956-127817978 TTTAAACACCAACAGGAACAAGG - Intergenic
1048416120 8:134229583-134229605 TTTGATAAGGAACAGTAACAAGG + Intergenic
1050282068 9:4060786-4060808 TTTAATAAGCAACAGAAAAATGG + Intronic
1050339351 9:4620303-4620325 TTTATGAAGCCACAGGAGGAAGG - Intronic
1050930565 9:11318810-11318832 TTTTAAAAGTAACAGGAAAATGG - Intergenic
1051394261 9:16602210-16602232 TTAAATAAGAAACCAGAAGAGGG - Intronic
1054951485 9:70857031-70857053 TTTACAGAGCAACAAGAAGATGG - Intronic
1055642207 9:78328333-78328355 TTCCATAAACAACAGGAAGAAGG - Intronic
1055826422 9:80330731-80330753 TTTTATAACCAACAGAAAGGGGG - Intergenic
1055958553 9:81797333-81797355 TTTCCTAAGAAACAGAAAGATGG - Intergenic
1055964240 9:81849972-81849994 TGTAAGATGCAACAGGAAGAGGG + Intergenic
1056041459 9:82671850-82671872 GATAATAAGCAACATGGAGAAGG + Intergenic
1056041488 9:82672168-82672190 GATAATAAGCAACATGGAGAAGG - Intergenic
1056923628 9:90813857-90813879 TTTAATAAGCAACACATAGGGGG + Intronic
1057887479 9:98841132-98841154 ATTAACAAGAAAAAGGAAGAGGG - Intronic
1058055543 9:100444962-100444984 TTTAATAATCACCAGCAAAAAGG - Intronic
1058162823 9:101588174-101588196 TTTAACAAGAATCATGAAGAGGG + Intronic
1058245739 9:102623511-102623533 TGTAATAATCAAAAGGAAGCTGG - Intergenic
1058518402 9:105797441-105797463 TTTAATATCCAAAAGGGAGAGGG - Intergenic
1058643949 9:107113123-107113145 TTTATTAATGAACAGGAGGAAGG - Intergenic
1059515914 9:114895180-114895202 TTTCACTTGCAACAGGAAGAGGG - Intronic
1203760379 EBV:10089-10111 TTTAACAAGCTGCAGGAAAAAGG + Intergenic
1203661166 Un_KI270753v1:44003-44025 TGTTATAAGCAACAGAAAAATGG + Intergenic
1203672350 Un_KI270755v1:27237-27259 TGTTATAAGCAACAGAAAAATGG + Intergenic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1187033661 X:15514707-15514729 TTTAAAAAGCCACGGGAATAGGG - Intronic
1187942327 X:24394106-24394128 TTTAATAAACAATAAGAAAAAGG - Intergenic
1188403693 X:29780145-29780167 TTTGATAATAAAAAGGAAGATGG - Intronic
1188922667 X:35996955-35996977 TTTAAAAAACAACAGGAGAATGG - Intergenic
1189421969 X:40864178-40864200 TGTTATAAGCAACAGAAAAAAGG - Intergenic
1190375171 X:49782253-49782275 TTTTATAAGCAACAAAAAAATGG - Intergenic
1190828628 X:54041471-54041493 TCTAACAAGCAACAGGAGGAGGG + Intronic
1193151811 X:78133228-78133250 TTTAATACCCAACAGGAAGGTGG - Intronic
1193358652 X:80554300-80554322 GTTCATAAGCCAAAGGAAGAGGG + Intergenic
1193696753 X:84717180-84717202 GTTACTACGCAACAGGATGAAGG + Intergenic
1194061764 X:89212259-89212281 TTTAAGAAACAAAAGGGAGAAGG - Intergenic
1195040222 X:101007344-101007366 TTTTAAAAGCAATAGGAAGTTGG + Intergenic
1195236254 X:102901649-102901671 TTTATTGAGCCCCAGGAAGAAGG + Intergenic
1195382700 X:104285801-104285823 TTTAAAAAGCAAGATGAAGAAGG + Intergenic
1197150048 X:123210192-123210214 TTTAGGAAGCAAAAGGAGGATGG - Intronic
1197730289 X:129803988-129804010 TTTATTAAGGAAAAGAAAGAGGG + Exonic
1198481330 X:137044146-137044168 ATGAATAAGCAACAGGCATAGGG - Intergenic
1198604919 X:138326465-138326487 AGTAATAAGCAAAAGAAAGATGG - Intergenic
1199118401 X:144020389-144020411 TTTAATGAGCCACTGGAAGAAGG - Intergenic
1199445711 X:147918219-147918241 TATGATGAGAAACAGGAAGATGG + Intronic
1199907385 X:152247199-152247221 TTTAATAATCAAGAGGAAAGTGG - Intronic
1200715687 Y:6541563-6541585 TTTAAGAAACAAAAGGGAGAAGG - Intergenic