ID: 1140381240

View in Genome Browser
Species Human (GRCh38)
Location 16:74489637-74489659
Sequence GCACCCTAGAAACAACACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140381235_1140381240 22 Left 1140381235 16:74489592-74489614 CCACACTGGCACAGAGGTTTCCC 0: 1
1: 0
2: 1
3: 11
4: 166
Right 1140381240 16:74489637-74489659 GCACCCTAGAAACAACACTGTGG 0: 1
1: 0
2: 2
3: 11
4: 130
1140381234_1140381240 23 Left 1140381234 16:74489591-74489613 CCCACACTGGCACAGAGGTTTCC 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1140381240 16:74489637-74489659 GCACCCTAGAAACAACACTGTGG 0: 1
1: 0
2: 2
3: 11
4: 130
1140381232_1140381240 29 Left 1140381232 16:74489585-74489607 CCAGGACCCACACTGGCACAGAG 0: 1
1: 0
2: 2
3: 33
4: 266
Right 1140381240 16:74489637-74489659 GCACCCTAGAAACAACACTGTGG 0: 1
1: 0
2: 2
3: 11
4: 130
1140381231_1140381240 30 Left 1140381231 16:74489584-74489606 CCCAGGACCCACACTGGCACAGA 0: 1
1: 1
2: 0
3: 28
4: 293
Right 1140381240 16:74489637-74489659 GCACCCTAGAAACAACACTGTGG 0: 1
1: 0
2: 2
3: 11
4: 130
1140381238_1140381240 1 Left 1140381238 16:74489613-74489635 CCAAGGAAGTCACCAGTAACAAC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1140381240 16:74489637-74489659 GCACCCTAGAAACAACACTGTGG 0: 1
1: 0
2: 2
3: 11
4: 130
1140381237_1140381240 2 Left 1140381237 16:74489612-74489634 CCCAAGGAAGTCACCAGTAACAA 0: 1
1: 0
2: 3
3: 10
4: 157
Right 1140381240 16:74489637-74489659 GCACCCTAGAAACAACACTGTGG 0: 1
1: 0
2: 2
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140381240 Original CRISPR GCACCCTAGAAACAACACTG TGG Intronic
901776099 1:11561308-11561330 GGACTCTAGAAGGAACACTGGGG - Intergenic
903032277 1:20472540-20472562 GCACTCTGGAAACAACAGAGTGG + Intergenic
906608652 1:47187710-47187732 GCTGCCTAGATACAGCACTGAGG - Intronic
907589520 1:55652800-55652822 GCAAGCTAGAAGCAACACTGGGG + Intergenic
911390392 1:97233736-97233758 AGACCCGAGAAACAACACAGTGG - Intronic
912951209 1:114121903-114121925 GCACCCTAGTCACAGCCCTGTGG + Intronic
917082562 1:171271650-171271672 GCTCCATAGAGACAGCACTGGGG - Intronic
917504007 1:175612065-175612087 GCATCCTAGAAAGGACTCTGTGG - Intronic
917672540 1:177286642-177286664 TTACCCAAGAAACAAAACTGTGG + Intergenic
918395336 1:184108823-184108845 GAACCATAGAAACAACACAATGG + Intergenic
921963485 1:221062310-221062332 GAACCCAAGAAACAACACTGTGG + Intergenic
923785128 1:237059183-237059205 GCACCCTCTTAACAAAACTGTGG - Intronic
924439422 1:244074059-244074081 GCACTCCAGAAAGAACACTGTGG + Intergenic
1063217140 10:3934856-3934878 CCACCCGAGAATCAACACTGTGG + Intergenic
1063579104 10:7289317-7289339 GCATGTTAGAAACAACCCTGTGG - Intronic
1064009908 10:11727533-11727555 GCAATTTAGAAACAACACTCTGG + Intergenic
1069762510 10:70821988-70822010 GAACCCAAAAAACAAAACTGAGG - Intronic
1070084969 10:73228419-73228441 GCAACCTAGAATCAACCATGTGG + Intronic
1072091458 10:92132283-92132305 CCAGCCTATAAACAAAACTGGGG + Intronic
1073627826 10:105118026-105118048 GGAACCTAGAAAGAACACTGAGG - Intronic
1075324540 10:121520292-121520314 ACACCTTTGAAATAACACTGTGG + Intronic
1076486979 10:130828056-130828078 CCTCCCTTGAAACAACACTCTGG - Intergenic
1077758421 11:5062316-5062338 TTACCCAACAAACAACACTGAGG - Intergenic
1077821233 11:5743309-5743331 CCACCCTAGACAGATCACTGTGG + Intronic
1078503580 11:11910245-11910267 GCACCCAAGGAATAACACGGTGG + Intronic
1078633250 11:13025202-13025224 GCACCCTAGCACCAATGCTGTGG + Intergenic
1082188096 11:49208577-49208599 GCACTCTAGAAACACTGCTGTGG - Exonic
1083732185 11:64658497-64658519 GAACCCTTCAAACAACTCTGAGG + Intronic
1094197597 12:27765731-27765753 CCAGGCTAGAATCAACACTGTGG - Intronic
1098818895 12:75206468-75206490 GAACCCGAAAAAGAACACTGAGG + Intronic
1099497909 12:83375562-83375584 GCAAACTAGAAACAACAAAGAGG - Intergenic
1099864658 12:88264701-88264723 GGACTCCAGAAACATCACTGAGG - Intergenic
1101919599 12:108921627-108921649 GCAGCCTTTAAACAATACTGTGG - Intronic
1104605053 12:130182008-130182030 GCACCCTAGAAAGAAAACCATGG + Intergenic
1105950732 13:25227560-25227582 GCACACTAGTAAAACCACTGTGG + Intergenic
1106840986 13:33684858-33684880 GCCCCCAAGAAACAATATTGAGG + Intergenic
1107446807 13:40476763-40476785 GCAATCTAGAACAAACACTGAGG + Intergenic
1112880159 13:104097391-104097413 GTAACTTAGAAACACCACTGAGG + Intergenic
1112896805 13:104309170-104309192 CCACCCTATACACAACACTGTGG + Intergenic
1116136097 14:40926161-40926183 GTAACCTAGAACCAAAACTGTGG - Intergenic
1119604252 14:76001139-76001161 GCATCTTAGAAAGAACACTTTGG + Intronic
1124509546 15:30311660-30311682 GGCCCCTAGAAACTTCACTGAGG - Intergenic
1124734014 15:32227002-32227024 GGCCCCTAGAAACTTCACTGAGG + Intergenic
1126412684 15:48388336-48388358 GCACCCTGCAAACCACACTAGGG - Intergenic
1127172993 15:56323031-56323053 GCTCCATAGAGACAGCACTGGGG + Intronic
1130171163 15:81516121-81516143 CCACTCTAGAATCTACACTGAGG + Intergenic
1130648420 15:85748354-85748376 GGAGCCTAGAAATAACCCTGTGG + Intronic
1130924340 15:88374049-88374071 GAAGCCTAGAAACATCACCGGGG + Intergenic
1138769370 16:59645533-59645555 GAACCCAAGAAACAACATGGTGG - Intergenic
1140381240 16:74489637-74489659 GCACCCTAGAAACAACACTGTGG + Intronic
1140957209 16:79876734-79876756 GCACCTTAGAACCAACAACGTGG + Intergenic
1149220018 17:54406216-54406238 TCACCCTTGAATCACCACTGTGG + Intergenic
1149677525 17:58479073-58479095 GCTGCCTAGGAATAACACTGCGG + Intronic
1150645539 17:66975490-66975512 GCATCATAGAATCAACCCTGGGG + Intronic
1151585788 17:75007682-75007704 GAAGCCTAGAAACAGGACTGTGG + Intergenic
1158918538 18:62163240-62163262 CTACTCTAGAAACAACACAGAGG + Intronic
1159902705 18:74062985-74063007 GCACCCAACAAACATCATTGTGG + Intergenic
1160122758 18:76145464-76145486 GCACCCTGGAATCCAGACTGGGG - Intergenic
1167662477 19:50804091-50804113 GCAACCTAGAACAAAGACTGGGG - Intronic
925206619 2:2012819-2012841 GCACCCTGCATACAACACTGCGG - Intronic
930340101 2:50101795-50101817 GCAACCTAAAAACAAGAGTGAGG + Intronic
933144389 2:78833670-78833692 GGACCCTAGAAATCACACTATGG + Intergenic
934908931 2:98232897-98232919 ACACCTCAGAGACAACACTGGGG - Intronic
938557377 2:132437812-132437834 GCTCCCTACATACAGCACTGGGG - Intronic
938703814 2:133902310-133902332 TCACCCCAGCAACAACACTCAGG - Intergenic
944452025 2:199852874-199852896 GCCCCCCACAAAGAACACTGGGG - Intergenic
1170583623 20:17717234-17717256 GCATCCAAGGAACAACCCTGGGG + Intronic
1172428881 20:34874397-34874419 AGACCCTACAAACATCACTGAGG - Intronic
1173129059 20:40370562-40370584 GCACACTAGAAAGGACTCTGAGG + Intergenic
1174720444 20:52806109-52806131 ACACCTTACAAACAAAACTGTGG - Intergenic
1180194421 21:46184355-46184377 GGAGCCAAGAAACAACACTGAGG - Exonic
1181273095 22:21672263-21672285 GCCACCTGGTAACAACACTGTGG - Intronic
1184801192 22:46761215-46761237 GTCCCCTACAGACAACACTGAGG - Intergenic
953635437 3:44659836-44659858 GCACCAGAGAACCCACACTGGGG + Exonic
954215353 3:49121398-49121420 GCACCAGAGACACAAGACTGCGG - Intronic
955553744 3:60112995-60113017 GCACACTATAGACTACACTGTGG - Intronic
955798720 3:62664493-62664515 GGAACCTAAAAACAGCACTGAGG - Intronic
957420234 3:79958204-79958226 GCTCCATAGAGACAGCACTGGGG - Intergenic
959100211 3:102001529-102001551 GAACCCTAGAAACTTCACTGAGG + Intergenic
959548100 3:107621314-107621336 GGACCCAAGAAACAACACAGTGG - Intronic
960059824 3:113309766-113309788 GAACCTGAGGAACAACACTGTGG + Intronic
962279350 3:134038594-134038616 GGGCCCTAGAAGCAAGACTGAGG - Intronic
962650685 3:137486437-137486459 GCACCATAAAAATAAAACTGTGG - Intergenic
969636967 4:8374910-8374932 GCTTCCTAGATACAACACGGGGG + Intronic
969998099 4:11335526-11335548 GCCCCTTAGAAACAAGACTTAGG - Intergenic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
974604015 4:64125463-64125485 TCACACTAGAAAAAAAACTGAGG + Intergenic
975429943 4:74277419-74277441 GCATCCTAGTAACTACAATGGGG - Intronic
978406498 4:108384926-108384948 GTACCCTAGAAACAACACAGTGG + Intergenic
981523227 4:145686649-145686671 AAACCCTGGAAACAACAGTGAGG + Intronic
984089987 4:175361071-175361093 CCACATTAGAAACAACACTCAGG - Intergenic
985130307 4:186732487-186732509 CCACACCAGAAACGACACTGTGG - Intergenic
985496262 5:208264-208286 GGACCCCAGGAACAACACGGGGG + Intronic
988258129 5:28848119-28848141 GCGTCCTAGAAACTTCACTGAGG - Intergenic
989527172 5:42466976-42466998 GCACCAGAGAACCCACACTGGGG - Intronic
992626945 5:78644909-78644931 GCACCATAGAGACAGCCCTGGGG - Intronic
994163442 5:96582686-96582708 GAGCCCCAGAAACAACTCTGAGG - Intronic
1001045150 5:168365687-168365709 GCACCCTACAAACAGCACACAGG - Intronic
1001851301 5:174969034-174969056 GCAACTTAGAAAATACACTGAGG - Intergenic
1001896154 5:175383259-175383281 GAACCCAAGAAACATCACTATGG + Intergenic
1002898882 6:1394250-1394272 CTACCCCAGAAACACCACTGCGG - Intronic
1003316246 6:5014629-5014651 GCAACCCAGATACAAGACTGGGG + Intergenic
1004502634 6:16222753-16222775 GCACCTTAGAGAGAACACAGTGG + Intergenic
1005258410 6:24030052-24030074 CCACCCTAGGAGCAAAACTGTGG + Intergenic
1005666999 6:28067890-28067912 GGACCCAAGGAACAACATTGTGG + Intergenic
1005675792 6:28153465-28153487 GCACCAGAGAATCCACACTGGGG + Exonic
1005693126 6:28326597-28326619 GCACCAGAGAATCCACACTGGGG - Exonic
1008679933 6:53861387-53861409 GCAACCTCTAAAAAACACTGAGG - Intronic
1011615812 6:89197410-89197432 GCAGCCTGAAAACCACACTGTGG + Intronic
1012178544 6:96121452-96121474 CCCCCCTAGGAAAAACACTGTGG + Intronic
1013306673 6:108853901-108853923 TCAGCCTACAAAAAACACTGAGG - Intronic
1013336818 6:109171947-109171969 CCACCCGAGATAAAACACTGAGG - Intergenic
1015408841 6:132868921-132868943 GCTCCATAGAGACAGCACTGGGG - Intergenic
1016143360 6:140641117-140641139 GCATCTTAGAAACGACGCTGTGG - Intergenic
1016403953 6:143710266-143710288 GAACCCAAGAAACAACACGGTGG - Intronic
1016637186 6:146306145-146306167 CCTCCCTAGAAGCCACACTGAGG - Intronic
1018394553 6:163367789-163367811 GCTCCTTAGGAAGAACACTGGGG - Intergenic
1020631181 7:10641800-10641822 GCATTCTAGATACATCACTGGGG + Intergenic
1022006839 7:26273406-26273428 ACGCCCTAGAATCACCACTGAGG - Intergenic
1022353936 7:29593184-29593206 GCACCTGAGATACAACAGTGAGG - Intergenic
1023357617 7:39382824-39382846 ACACCCCAGAAACAGGACTGGGG + Intronic
1024096443 7:45986536-45986558 GAACCATAGAAACAACACAGAGG - Intergenic
1024969243 7:55053608-55053630 TCCACTTAGAAACAACACTGTGG + Intronic
1029316577 7:99720943-99720965 GCACCCTGCAGACAGCACTGTGG + Intronic
1030118579 7:106083633-106083655 GAACCCAAGAAACAACATAGTGG + Intergenic
1035328799 7:158083347-158083369 GTACCCCCGAAACAACGCTGAGG + Intronic
1036527401 8:9547951-9547973 GACCCCTAGAAACTTCACTGGGG + Intergenic
1036587677 8:10139875-10139897 GCACTTTACACACAACACTGAGG - Intronic
1039441728 8:37599686-37599708 GCACCCAAGAAACCAGCCTGTGG + Intergenic
1040660270 8:49565303-49565325 GCACTCTAAAAACAATATTGTGG - Intergenic
1041468654 8:58183926-58183948 GGGCCCTTGAAGCAACACTGTGG + Intronic
1043128749 8:76434029-76434051 GAAACCTAGAAACAACAAGGTGG + Intergenic
1044363922 8:91321075-91321097 GCACTGTAGAAACCACACAGTGG - Intronic
1047445307 8:124913953-124913975 GCCCCCTAGAACCTAGACTGGGG - Intergenic
1051175093 9:14352633-14352655 ACAGCGTAGAAACAGCACTGAGG - Intronic
1051991375 9:23156230-23156252 GCCCCTTAGAAACAGCACTCAGG - Intergenic
1053225327 9:36350150-36350172 GCACCCAAGAAAACACAATGGGG - Intronic
1057104401 9:92397967-92397989 GAAGGCTAGAAAGAACACTGTGG - Intronic
1058281043 9:103115282-103115304 GGACCTAAGAAACAACACAGTGG + Intergenic
1186757025 X:12682358-12682380 TGACTCTAGAAACAACACAGAGG - Intronic
1190814903 X:53921356-53921378 GGACCCAAGAAACAACACATTGG - Intergenic
1197956509 X:131955156-131955178 GCACACAAGAAAGAAAACTGGGG + Intergenic
1198448918 X:136746806-136746828 CAATCCTTGAAACAACACTGGGG - Intronic
1200078214 X:153562339-153562361 TCACCCTAGGAAGCACACTGAGG + Intronic