ID: 1140382608

View in Genome Browser
Species Human (GRCh38)
Location 16:74504083-74504105
Sequence CATGGTTACAAGGACTTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140382608_1140382617 18 Left 1140382608 16:74504083-74504105 CCTATGAAGTCCTTGTAACCATG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1140382617 16:74504124-74504146 GCGAGGGGATGAATCTAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 122
1140382608_1140382612 1 Left 1140382608 16:74504083-74504105 CCTATGAAGTCCTTGTAACCATG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1140382612 16:74504107-74504129 AAAAAATGCAGGAGACAGCGAGG 0: 1
1: 0
2: 0
3: 37
4: 362
1140382608_1140382615 14 Left 1140382608 16:74504083-74504105 CCTATGAAGTCCTTGTAACCATG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1140382615 16:74504120-74504142 GACAGCGAGGGGATGAATCTAGG 0: 1
1: 0
2: 0
3: 12
4: 122
1140382608_1140382613 2 Left 1140382608 16:74504083-74504105 CCTATGAAGTCCTTGTAACCATG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1140382613 16:74504108-74504130 AAAAATGCAGGAGACAGCGAGGG 0: 1
1: 0
2: 2
3: 29
4: 376
1140382608_1140382616 15 Left 1140382608 16:74504083-74504105 CCTATGAAGTCCTTGTAACCATG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1140382616 16:74504121-74504143 ACAGCGAGGGGATGAATCTAGGG 0: 1
1: 0
2: 0
3: 5
4: 72
1140382608_1140382610 -10 Left 1140382608 16:74504083-74504105 CCTATGAAGTCCTTGTAACCATG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1140382610 16:74504096-74504118 TGTAACCATGCAAAAAATGCAGG 0: 1
1: 0
2: 0
3: 12
4: 167
1140382608_1140382614 3 Left 1140382608 16:74504083-74504105 CCTATGAAGTCCTTGTAACCATG 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1140382614 16:74504109-74504131 AAAATGCAGGAGACAGCGAGGGG 0: 1
1: 0
2: 3
3: 20
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140382608 Original CRISPR CATGGTTACAAGGACTTCAT AGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
907531579 1:55103969-55103991 CAACATCACAAGGACTTCATAGG + Exonic
908573897 1:65439066-65439088 AATGGTGACAAGAACTGCATGGG - Intronic
909516186 1:76509894-76509916 CATGCCAAAAAGGACTTCATAGG - Intronic
910361211 1:86415107-86415129 CATGGTTTCAAGTATTTCACTGG + Intergenic
910535937 1:88297609-88297631 CAAGGTTACAGGGGCTTTATGGG + Intergenic
912243820 1:107939945-107939967 CAAGCTTCCAAGAACTTCATGGG - Intronic
916807028 1:168269265-168269287 CAAAGTTAACAGGACTTCATTGG + Intergenic
916885707 1:169065731-169065753 CATGGAAAAAAGGACTTTATAGG - Intergenic
918254693 1:182738758-182738780 CTTGGTTTCAAGGTCTTTATTGG - Intergenic
918779318 1:188676359-188676381 CATGTCGACAAGGAATTCATAGG - Intergenic
918888514 1:190231155-190231177 CATGGCTTGAAGGACTTAATAGG + Intronic
919414072 1:197284942-197284964 CATGATTTCAAGGACATCATAGG - Intronic
920577675 1:207073643-207073665 CAGGGTTCCAAGGACTTCTCTGG - Exonic
1063860546 10:10303065-10303087 AATGGTGAAAAGGACTTCCTCGG + Intergenic
1066070156 10:31800243-31800265 CATGGATACAAGGAAATTATTGG - Intergenic
1068761426 10:60714805-60714827 CATGGTTGCCAGGGGTTCATGGG + Intronic
1072069911 10:91906190-91906212 CATGCTTACAAGCAATTCACAGG + Intergenic
1073462332 10:103673099-103673121 CATACATCCAAGGACTTCATAGG + Intronic
1075630950 10:124000323-124000345 CATGGTTTGAAGGACTGCAGGGG + Intergenic
1079290096 11:19180255-19180277 CATGGAGGCCAGGACTTCATTGG + Intergenic
1081562809 11:44234302-44234324 TATAGTTACAAGAACTTCCTAGG - Intronic
1082954340 11:58852932-58852954 GTTGGTTACAAGCACTTCACTGG - Intronic
1087918717 11:103841324-103841346 CATGGGTACAAGGATTCTATAGG - Intergenic
1088949093 11:114547303-114547325 CATGGTTAAACAGAATTCATGGG - Intronic
1096124138 12:49107291-49107313 CAGCCCTACAAGGACTTCATTGG + Intronic
1100478666 12:94957084-94957106 CATGGTCACAATCACATCATGGG - Intronic
1101612811 12:106307072-106307094 AATGGGTACAAGGACTTGAAGGG - Intronic
1101651557 12:106681868-106681890 CTTGGTTGCAATGACTTAATAGG - Intronic
1102715446 12:114967833-114967855 CATGTTTACTATGACTCCATGGG - Intergenic
1102847396 12:116201020-116201042 CATGGTTTCAAGGCCAGCATGGG - Intronic
1105599570 13:21874666-21874688 CAGGGTTTCAAGGACTTGAAGGG + Intergenic
1106790234 13:33147822-33147844 CATGATTACTATGGCTTCATAGG - Intronic
1106938601 13:34751258-34751280 CATGGTTACAATGCCTGCACTGG + Intergenic
1107353485 13:39541284-39541306 CATGGAAAAATGGACTTCATTGG - Intronic
1108701232 13:52945981-52946003 CATCTTCACAAGGCCTTCATAGG + Intergenic
1113971776 13:114196767-114196789 CATGTTTTCAAGGACTTCCTGGG - Intergenic
1115512108 14:34147628-34147650 CATGGTTACTATGACATCCTCGG + Intronic
1116126383 14:40792779-40792801 CATGCTTACAAATACTTTATTGG + Intergenic
1116720621 14:48490914-48490936 CATTGTTACAGATACTTCATTGG - Intergenic
1124058113 15:26261109-26261131 CACGGTAACAAGGTCTTCACAGG - Intergenic
1124071398 15:26396393-26396415 CCTGGTTACTAGGAATTAATTGG - Intergenic
1127164172 15:56226766-56226788 CATGGTAATAAGGAAATCATTGG - Intronic
1129105206 15:73302362-73302384 CAGGGTCACAATGACTTCACAGG - Intronic
1135702128 16:24641684-24641706 CATGTTTACAAATAATTCATAGG - Intergenic
1139967969 16:70756056-70756078 CACGGTGACAAGGACTGCTTGGG + Intronic
1140382608 16:74504083-74504105 CATGGTTACAAGGACTTCATAGG - Intronic
1144714086 17:17422192-17422214 AATGGGTACAAGGCCTTGATGGG - Intergenic
1146781476 17:35677377-35677399 CATGGTTACAAAGATTTTTTTGG + Intronic
1150980267 17:70133394-70133416 CACGTTTACAACGACTTGATTGG - Exonic
1151086127 17:71382938-71382960 CATGGTTAGAAGGGCTTCAAAGG - Intergenic
1161025262 19:2033856-2033878 CAGGGCTAGAAGGACTTCATGGG + Intronic
1161118952 19:2514575-2514597 CATTGGTAAAAAGACTTCATAGG - Exonic
925183386 2:1831158-1831180 CATCTGGACAAGGACTTCATGGG - Intronic
930990966 2:57654337-57654359 CATGGTTAAAAGGAGTTTACAGG + Intergenic
932673591 2:73758776-73758798 CGTGGTCAGAAGGACCTCATAGG - Intergenic
932820768 2:74897847-74897869 CCTGGTAACTAGAACTTCATTGG + Intergenic
943317558 2:186409348-186409370 CATGAGAACAGGGACTTCATTGG - Intergenic
945775594 2:214102931-214102953 CCTTGTTGCTAGGACTTCATGGG + Intronic
946079526 2:217105734-217105756 CAGGGTTACAGGGAGCTCATAGG + Intergenic
947071621 2:226293803-226293825 CATGGTGAGAAGGAATTCTTAGG - Intergenic
1170334073 20:15248907-15248929 CTTGGTTACAAGGAATTTATTGG + Intronic
1170393633 20:15902819-15902841 CATTGTGACAACAACTTCATGGG + Intronic
1173565580 20:44036035-44036057 CATGGTTACAAGCCCTTCCAAGG - Intronic
1180224401 21:46381516-46381538 CATGGGTTCAAGGACTTCACTGG - Intronic
953276388 3:41503372-41503394 CATGGCTACAAGGAGTGCAAAGG + Intronic
958902488 3:99904337-99904359 AATGGTTACAAATACTTGATTGG - Intronic
961265009 3:125634656-125634678 CATGGCTGTAAGGAGTTCATTGG - Intergenic
961808363 3:129505659-129505681 CATGGCTACAAGTGCTTCACTGG + Intronic
966668659 3:182501932-182501954 TATGATTTCTAGGACTTCATGGG + Intergenic
969366828 4:6700286-6700308 AATGGCTACAAGGAATTTATTGG + Intergenic
972853587 4:43079069-43079091 CAGTGTTACAAGGACTTTAAAGG + Intergenic
975173589 4:71261195-71261217 CAAGGGAACAAGGACTTCAAGGG + Intronic
976491473 4:85675662-85675684 CATGGTTGGAATGACTCCATAGG - Intronic
977243531 4:94602785-94602807 CATGGTTAGAATAACTTCAGTGG - Intronic
979549538 4:121975519-121975541 CTTGGTTAAAAGAAATTCATGGG - Intergenic
980159481 4:129142169-129142191 AAAAGTTACAAGGTCTTCATTGG - Intergenic
980475878 4:133315697-133315719 CATGGTGATAAGGACTGAATAGG + Intergenic
984245159 4:177266848-177266870 CATGGTTACAAAGATCTGATTGG - Intergenic
985739641 5:1607274-1607296 CACATTTACAAGGACTTGATGGG - Intergenic
987943853 5:24578184-24578206 CTTGGTTACAATGTATTCATTGG - Intronic
992538019 5:77731447-77731469 CATGGTTGTGAGCACTTCATAGG - Intronic
993054227 5:82963183-82963205 CATGGAAGCAAGGTCTTCATGGG - Intergenic
994452212 5:99956399-99956421 CACGGTTGCAAGGTCTGCATGGG - Intergenic
995080096 5:108041051-108041073 CATGGAGATAATGACTTCATGGG + Intronic
997325591 5:133018050-133018072 CCTGGTTTCAAGCAATTCATAGG - Intronic
999904574 5:156125693-156125715 CATGGTTTCAAGGACCAAATAGG + Intronic
1000184526 5:158846276-158846298 CATGATTAAAAGGACCTCTTTGG + Intronic
1006442994 6:34063626-34063648 CATGTTTACTAGGAGCTCATGGG + Intronic
1007321508 6:41031696-41031718 CATGGTGACAATGATCTCATTGG + Exonic
1007732099 6:43953646-43953668 GATGGTGAGAAGGACTCCATAGG + Intergenic
1010723863 6:79311936-79311958 CAAAGTTAAAAGCACTTCATTGG + Intergenic
1018692655 6:166361323-166361345 CTTTGTTACAATAACTTCATGGG - Intergenic
1020886835 7:13828652-13828674 AATGTTTACATGGAATTCATAGG + Intergenic
1023631974 7:42174076-42174098 CATGGTTTCAAGTATTCCATAGG + Intronic
1024328225 7:48130286-48130308 CATAGTTACAAAGATTTGATTGG + Intergenic
1024602025 7:50991146-50991168 CAGGGTAACACTGACTTCATGGG - Intergenic
1033083126 7:138316786-138316808 CATAGTTACAATGATCTCATTGG - Intergenic
1033779092 7:144648250-144648272 CATGATTACAGGGACATCACAGG - Intronic
1033839315 7:145354584-145354606 TCTGGTTACTAAGACTTCATGGG - Intergenic
1034635441 7:152563747-152563769 CATGGCTACAGGGACCTCAGTGG - Intergenic
1039823271 8:41152519-41152541 CATGGTAACTAGGATTTGATGGG + Intergenic
1042203524 8:66304930-66304952 CATGGTTACAAGGACTAGAATGG + Intergenic
1043910010 8:85853382-85853404 CATGGCCACAAGGATCTCATTGG - Intergenic
1045021537 8:98048667-98048689 CATGGTTACAATAACCTCATAGG + Intergenic
1051870656 9:21734187-21734209 CAAATTTCCAAGGACTTCATAGG - Intergenic
1056620414 9:88207899-88207921 TCTGGATACAAGTACTTCATTGG - Intergenic
1187889035 X:23916278-23916300 CATGGTTACAAGTATTTTAGTGG + Exonic
1188985896 X:36768068-36768090 GATGGTTACAAGGAGCACATTGG - Intergenic
1192139407 X:68634721-68634743 GATGGTTAGAAAGGCTTCATAGG + Intergenic
1194003973 X:88467599-88467621 CAATGTTACAAGGACTTTAAAGG - Intergenic
1194685284 X:96906523-96906545 AATAGTCACAAAGACTTCATGGG + Intronic
1195494317 X:105512441-105512463 TATGGTTACTAATACTTCATGGG - Intronic
1196588354 X:117456950-117456972 CATGGTAACAAGGATTTTACAGG - Intergenic
1197392205 X:125881703-125881725 CATTGTTGTAAGAACTTCATAGG + Intergenic
1199837097 X:151602392-151602414 CCTGCTTAAAAGCACTTCATGGG + Intronic
1200861877 Y:8001709-8001731 CATGGGTTCAAGCAATTCATCGG + Intergenic