ID: 1140385296

View in Genome Browser
Species Human (GRCh38)
Location 16:74531204-74531226
Sequence CTGTATAAGCAGAGACAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140385296 Original CRISPR CTGTATAAGCAGAGACAGAT TGG (reversed) Intronic
901444301 1:9298233-9298255 CTGTATAAGCAGAAACTTACAGG + Intronic
902157105 1:14497209-14497231 ACTAATAAGCAGAGACAGATAGG + Intergenic
905997976 1:42398565-42398587 CTATATAAACAGATACAAATTGG - Intronic
906302855 1:44696211-44696233 CAATAGAAGTAGAGACAGATTGG - Intronic
907718126 1:56946802-56946824 CTGTATAGGCAGAGAAAAAGAGG + Intronic
908046354 1:60173668-60173690 CTGTCTAAACTCAGACAGATTGG + Intergenic
910003976 1:82372232-82372254 CTTTTCAAGCAGAGACAGGTTGG + Intergenic
910014852 1:82509526-82509548 CTGTGAAAGCTGAGAAAGATGGG + Intergenic
911113403 1:94217024-94217046 CTGTATAAGAAGTGAGAAATTGG - Intronic
912954425 1:114144493-114144515 CAGTTTAACCAGAGACAGACAGG - Intronic
914228490 1:145742764-145742786 CTATTTAATCAGAGACTGATTGG + Exonic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917844383 1:179008225-179008247 CTCTATAAGCAGTAACAGACTGG + Intergenic
918331242 1:183462984-183463006 TTGAAAAAGCAGAGAAAGATGGG + Intergenic
920967504 1:210713309-210713331 CAATATCAGCAGACACAGATTGG + Intronic
923761639 1:236850938-236850960 CTGGAAAAGGAGAGACAGACGGG - Intronic
1064587841 10:16856749-16856771 CTGTACGAGCAGATACAGACTGG + Intronic
1066512256 10:36114336-36114358 ATGTACATGAAGAGACAGATAGG + Intergenic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1069228156 10:65970089-65970111 ATTTATAAGCCGAGACAGATTGG + Intronic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1070337358 10:75467361-75467383 CTGAATAAACAGAGACAACTAGG - Intronic
1070868358 10:79724686-79724708 CTCTAGAAGCTGAGACAGACAGG + Intergenic
1071635271 10:87246887-87246909 CTCTAGAAGCTGAGACAGACAGG + Intergenic
1071659977 10:87491100-87491122 CTCTAGAAGCTGAGACAGACAGG - Intergenic
1073234767 10:102004725-102004747 CTGAATAAACAGAGACAAGTAGG + Intronic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1074701552 10:116096995-116097017 CTGAATAAACAGAGACACACAGG - Intronic
1074839187 10:117331441-117331463 CTATATAAGTTGAGACAAATGGG + Intronic
1075478084 10:122753840-122753862 CTGGCTAAGCAGAGTCATATGGG - Intergenic
1076042078 10:127258966-127258988 CTGGGGCAGCAGAGACAGATTGG + Intronic
1076730982 10:132438765-132438787 CTGCCCATGCAGAGACAGATGGG + Intergenic
1078093430 11:8282055-8282077 TGGTATTAGCAGACACAGATGGG + Intergenic
1078856013 11:15206892-15206914 CTGGAAAAGTAGAGACAAATGGG - Intronic
1081135320 11:39433132-39433154 CTGTATAAAGAGAGACACACGGG - Intergenic
1081523587 11:43907237-43907259 GTGTTTAAGCAGATAAAGATTGG + Intronic
1085811269 11:79683741-79683763 CTATATAAGCAGTGCCAAATGGG - Intergenic
1087195930 11:95304268-95304290 TTCTATAAGCAGAGATATATCGG + Intergenic
1089553764 11:119302910-119302932 CTGTATAAGAAGAGAAAGAGAGG - Exonic
1091359133 11:134960971-134960993 CTGGATAAGAAGAAACTGATAGG + Intergenic
1091430438 12:429089-429111 CTGTTTTAGCTGAGACAGAGAGG + Intronic
1091687566 12:2574554-2574576 CTGATTCAGCACAGACAGATTGG + Intronic
1094571422 12:31644543-31644565 CTGTATGTGCAGCAACAGATAGG - Intergenic
1095585467 12:43844601-43844623 CTGTATAAGAAAAGATAGATAGG - Intronic
1095845132 12:46736376-46736398 CCTTATAAGCTGAGAGAGATTGG + Intergenic
1097154864 12:57005493-57005515 TAGTATAGGCAGAGAGAGATGGG - Intronic
1097701761 12:62827664-62827686 ATGTATAGGCAAAGACAGGTTGG - Intronic
1098619923 12:72582906-72582928 CTGTAAAAACAGAAAAAGATAGG - Intronic
1098676162 12:73292698-73292720 ATGTATCAGAAGAGACAGAGTGG + Intergenic
1099926144 12:89020285-89020307 CTGTGCATGCAGAGACACATAGG + Intergenic
1100571987 12:95851657-95851679 CTGTATAAAAAGAGAAAGAAGGG - Intergenic
1101328127 12:103734904-103734926 CTGTGATGGCAGAGACAGATTGG - Intronic
1103048125 12:117755573-117755595 CAGGAAAAGGAGAGACAGATGGG - Intronic
1110713818 13:78679128-78679150 CTGCATAAGCAAAGACATAGAGG - Intergenic
1111151989 13:84264783-84264805 CTTTATAAGAAGAGACATCTGGG + Intergenic
1112000113 13:95202332-95202354 ATGTACATGCAGAGAGAGATTGG - Intronic
1112621794 13:101060784-101060806 TAGTATATGCCGAGACAGATTGG - Intronic
1115751244 14:36492608-36492630 CTGTATAGGCAGACAGACATTGG - Intronic
1116737283 14:48708109-48708131 GTGTAAAAGGAGAGACATATTGG - Intergenic
1117740380 14:58812681-58812703 CTCTGTCAGCAGGGACAGATGGG - Intergenic
1118112359 14:62735836-62735858 CTTTATAAAAAGAGACAGATAGG + Intronic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1120059094 14:79960705-79960727 CTACATAAGCTGATACAGATAGG - Intergenic
1120381184 14:83781788-83781810 CTGTAGCAGGAGAGACTGATAGG - Intergenic
1120747894 14:88168305-88168327 CTGTATAGGAAGAGAGAGATAGG - Intergenic
1122203455 14:100136444-100136466 CTGTCTAAGCTGTGGCAGATGGG + Intronic
1124025420 15:25961122-25961144 CTGTTTAAGCAGTGACATTTTGG - Intergenic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1126000069 15:44200648-44200670 TTGTATAAGCAAAGACACAGAGG + Intergenic
1127341490 15:58049591-58049613 CTAAACCAGCAGAGACAGATAGG + Intronic
1127796272 15:62441137-62441159 CAGTACAAGCAGAGATGGATTGG + Intronic
1128308377 15:66614907-66614929 CTTAATGAGCAGGGACAGATGGG + Intronic
1132294342 15:100724545-100724567 CTGTGAAAGCAGCCACAGATGGG + Intergenic
1137372870 16:47924918-47924940 TTGTATAAGCAGAGGCACAGTGG + Intergenic
1138037155 16:53620479-53620501 CTGTATTAGTGGAGACAGAATGG - Intronic
1138159436 16:54739609-54739631 ATATATAAACAGATACAGATAGG - Intergenic
1139870149 16:70101349-70101371 CTGTATAAGCAGAGACAGATTGG + Intergenic
1140232188 16:73126455-73126477 CTGAAGAAACAGAAACAGATGGG + Intergenic
1140385296 16:74531204-74531226 CTGTATAAGCAGAGACAGATTGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1147166924 17:38598458-38598480 CTGCACAAGCAGAAACAGCTAGG + Intronic
1147861738 17:43527963-43527985 GGGTATAAGCAGAGAGGGATGGG - Exonic
1148536644 17:48444694-48444716 CTGCATAGGCAGCGACAAATGGG - Intergenic
1148681624 17:49477367-49477389 CTGTATAAGCTGACACAAGTAGG - Intergenic
1150453424 17:65288186-65288208 CCTTATAAGAAGAGACACATGGG + Intergenic
1154495847 18:14960269-14960291 CTGGATAAGAAGAAACTGATAGG - Intergenic
1157400884 18:47385904-47385926 TAGTATAAGAAGAGACACATAGG - Intergenic
1160139789 18:76311239-76311261 CTGGAGAAGCAGACACAGCTCGG - Intergenic
1161751051 19:6097017-6097039 CAGTATAATCAGAAACAGAAAGG + Intronic
1164288842 19:23849189-23849211 CTGTATAGGAATAGTCAGATTGG + Intergenic
925491577 2:4400944-4400966 CCTTATAAGGAGAGAGAGATTGG + Intergenic
926802132 2:16667637-16667659 CTGTATTAGTAGAGACAGATGGG - Intergenic
926817940 2:16819151-16819173 CTTTATAAGCAGAGAAAGGCTGG - Intergenic
927534372 2:23842435-23842457 GTGAGTAAACAGAGACAGATGGG + Intronic
928926311 2:36583228-36583250 CTGTATAACCAGAAAAAAATAGG + Intronic
930412683 2:51046757-51046779 CAGTATCAGGAGAGAAAGATAGG - Intergenic
931413307 2:62056072-62056094 CAGTATATGCACAGACAGAGTGG + Intronic
932556457 2:72829181-72829203 ATGTAGAAGCAGAGATAGAGTGG - Intergenic
933492767 2:83008712-83008734 CTTTATAAGAAGAGAGAGAGAGG + Intergenic
939643346 2:144667231-144667253 CTGTAAAATGAGAGGCAGATAGG + Intergenic
940024739 2:149193999-149194021 TTAAATAAGCAGAGAGAGATGGG - Intronic
940976642 2:159953288-159953310 CTGAATAAGAAGAGACACAAGGG - Intronic
945969750 2:216223948-216223970 CTAATGAAGCAGAGACAGATTGG - Intergenic
947129672 2:226908476-226908498 CTGTACAAGCAGAGACACTCTGG - Intronic
947263726 2:228252865-228252887 CTTTATAAGCCAAGAAAGATTGG - Intergenic
948605665 2:239133166-239133188 CTGTCTAAACAGAGACACATGGG + Intronic
1169436294 20:5594676-5594698 CTGTCTTAGCAGAGCCAGGTAGG - Intronic
1170715488 20:18827633-18827655 CTTTATAAGCAGAGGAAGAGAGG + Intronic
1171014608 20:21528887-21528909 CTTTAGAAGCATGGACAGATGGG - Intergenic
1173033910 20:39390374-39390396 CTGCCTAAGCAGAAGCAGATTGG - Intergenic
1175084305 20:56445803-56445825 CTCCAAAAGCAGAGACAGCTGGG - Intronic
1177427295 21:20939896-20939918 TTGAATAAGCAGACACAGTTAGG - Intergenic
1178669918 21:34581305-34581327 CTGCCTAAGCAGAGGCAGTTTGG - Intronic
1179201221 21:39223212-39223234 CTGTATAAGAAGGGAAATATAGG + Intronic
1179461415 21:41537980-41538002 CTGCAGAAGCAGAGACAGACGGG - Intergenic
1181349751 22:22246520-22246542 CTGTATTTACAGAAACAGATGGG + Intergenic
1181918309 22:26298682-26298704 CTATCTATGTAGAGACAGATTGG - Intronic
950955586 3:17050150-17050172 CTGTATAAGGAGAGAGATAGGGG - Intronic
952724025 3:36563077-36563099 CTGTATGGGTAGAGACAGAGAGG + Intergenic
953182764 3:40612079-40612101 CTTTCCAAGCAAAGACAGATAGG + Intergenic
953199148 3:40762357-40762379 CTGTATATGGTGAGACATATGGG - Intergenic
955167890 3:56532961-56532983 GTGTAGAAGCAGAGACATATGGG - Intergenic
957026866 3:75192376-75192398 CACTAGAAGCAGAGACAGAGGGG - Intergenic
957041419 3:75338293-75338315 CTGCATAAGCAAAACCAGATGGG - Intergenic
958108352 3:89106501-89106523 TAGTATAAGAAGAGATAGATGGG + Intergenic
958727543 3:97924081-97924103 CAGTACAAGGAGAGACAAATGGG + Intronic
959470435 3:106743508-106743530 CTGTCTAGGAAGAGACAAATTGG + Intergenic
959489670 3:106973299-106973321 ATGTAAAAGCAGAGACACAGGGG + Intergenic
960445119 3:117738804-117738826 CTGTTTAAGTACAGGCAGATTGG - Intergenic
960841572 3:121963896-121963918 CTGCAGAAGCAGTGACAGAGAGG - Intergenic
961015512 3:123465333-123465355 CAGAATCAGCAGAGACAGCTGGG - Intergenic
963258682 3:143171917-143171939 CTGTATAAGCAGAAAAAATTGGG + Intergenic
964298206 3:155257613-155257635 CTGTCTCAGCAGACACAGCTAGG - Intergenic
964402928 3:156318056-156318078 CTTTAAAAGCAGTGACAGAGAGG + Intronic
964578344 3:158200355-158200377 TTAAATAAGCAGACACAGATAGG - Intronic
969272597 4:6113016-6113038 CTGAGTTAGCAGAGACAGAAGGG + Intronic
970573787 4:17407842-17407864 CTATAAAAGTAGAGACAGAGAGG - Intergenic
971632230 4:29008020-29008042 CTCTATAACAAAAGACAGATTGG - Intergenic
972237929 4:37155568-37155590 GTGTACATGCAGAGACAGCTGGG - Intergenic
977011213 4:91636001-91636023 CTGAATAAGAGGAGACAGCTAGG + Intergenic
978316040 4:107438410-107438432 CTGTATATGGACAGACAGATTGG - Intergenic
980203617 4:129688961-129688983 ATAAATAAGCAGAGTCAGATGGG - Intergenic
981894137 4:149777246-149777268 GAGTAGAAGCAGAGACAAATTGG - Intergenic
982553214 4:156828296-156828318 CTGTATCAGAAGAGTGAGATGGG - Intronic
984380059 4:178981594-178981616 CTATATAAGCAGAAATATATAGG - Intergenic
984606798 4:181795362-181795384 CTTTATAAGAAGAGACACAGGGG - Intergenic
984907085 4:184638358-184638380 CTTTATAATCAGAGAAAGATGGG - Intronic
985482413 5:122839-122861 GAGTATTACCAGAGACAGATAGG + Intergenic
986484142 5:8218191-8218213 CACTAGAAGCAGAGACAGAAAGG - Intergenic
987464611 5:18256927-18256949 CTGTAGAAACAGAGATAGAGAGG + Intergenic
987798156 5:22656473-22656495 CTGTATGAGCATAGACATAGTGG + Intronic
987822929 5:22989535-22989557 ATGAATAAGCAAAGACAGATAGG + Intergenic
987978432 5:25046522-25046544 CTTTATAAGCAGTGTCAGGTGGG - Intergenic
988238017 5:28572093-28572115 CAGTCTAAACAGAGACACATTGG - Intergenic
988412268 5:30901722-30901744 CACTATAAGCATATACAGATAGG + Intergenic
990091448 5:52056034-52056056 CTGTGTAGACAAAGACAGATAGG - Intronic
990360018 5:55008839-55008861 CTGTATAAGCCAAAACAGATTGG + Intronic
991111003 5:62899297-62899319 TAGTATAAGCAGAGAGAGAGAGG + Intergenic
994727808 5:103456805-103456827 CTTTATAGGAAGAGAGAGATTGG - Intergenic
997900446 5:137758883-137758905 CAGTATATGCACAGACAGAGTGG - Intergenic
998738600 5:145172295-145172317 CTGAATAAGCTGAGAGAGAGAGG - Intergenic
999874590 5:155788757-155788779 CTTTATTTGCAGAGGCAGATAGG + Intergenic
1001888586 5:175319072-175319094 CTTTATAAGAAGAGAGAGAGCGG + Intergenic
1001955285 5:175844546-175844568 TTGTATAAGCAAAGTCAGAGAGG + Intronic
1002554726 5:180027387-180027409 GAGTATAAGCAGAAACAGAAAGG + Intronic
1002699278 5:181111111-181111133 CGGGATGAGCAGTGACAGATGGG - Intergenic
1003044103 6:2717071-2717093 CAGTATGAGCAGAAACAGGTTGG + Intronic
1003055035 6:2810350-2810372 CTGTCTCAGCAGAGACTGAAGGG - Intergenic
1003491817 6:6628743-6628765 CCATGTCAGCAGAGACAGATAGG - Intronic
1003511343 6:6783564-6783586 CTGGAAATGCAGAGGCAGATAGG - Intergenic
1005306432 6:24518372-24518394 CTGGAGAAGCAGAGACTGAGTGG + Intronic
1005788108 6:29267872-29267894 TTATCTAAGCAGAGAAAGATAGG + Intergenic
1009273914 6:61650510-61650532 GTGAATAAGCACAGTCAGATGGG + Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1013318528 6:108964112-108964134 CTGTAAAACAAGAGACAGCTGGG + Intronic
1013615545 6:111839795-111839817 TTGTATCACCAGAGACAGCTTGG + Intronic
1014190944 6:118496051-118496073 CAGTATACGCACAGACAGAGAGG + Intronic
1014671840 6:124314041-124314063 CTGTATAAGCAAAAACTGAAAGG - Intronic
1014794545 6:125709551-125709573 CTTTATATGAAGACACAGATAGG - Intergenic
1015175744 6:130306242-130306264 CTGTCTAAGCAGAAAAATATAGG + Intronic
1016009721 6:139126839-139126861 TTGTATTAGGAGAGAGAGATTGG + Intergenic
1019847949 7:3525326-3525348 GTTTATCAGCAGACACAGATGGG + Intronic
1022165028 7:27750466-27750488 CTGTATAAGCAGAGGCTTAGAGG + Intronic
1022296062 7:29054729-29054751 ATGTCTAAGCAGAGTCAGAGAGG - Intronic
1022499899 7:30876275-30876297 CTGTATAAGAAAAGACACAAAGG - Intronic
1023556357 7:41427130-41427152 CCGTATAAGCAAAGGCATATAGG - Intergenic
1023956071 7:44887629-44887651 CTGAATATGGAGGGACAGATTGG + Intergenic
1024934891 7:54702074-54702096 CTGTAGAGGCAGAGACAGGCGGG + Intergenic
1027969895 7:85066192-85066214 CTGTTTCACCAGAGACAGAAAGG + Intronic
1031455249 7:121971288-121971310 CTTTATAACCAGAGAAAAATGGG + Intronic
1031512984 7:122671696-122671718 CTGGATAAGCAAAGAAGGATAGG + Intronic
1031767664 7:125802112-125802134 CTGTATAAGCAGAGAGCTCTAGG + Intergenic
1032674037 7:134111626-134111648 TTGCATAAGCAGACTCAGATGGG - Intergenic
1032790875 7:135241542-135241564 CTGCATGAGCAGAGACACAGAGG - Intronic
1033196215 7:139329707-139329729 CTGTACAAGCAGAAACATACTGG - Intergenic
1038585543 8:28785568-28785590 CTGTATGCTCAGAGAAAGATGGG - Intronic
1039646584 8:39290849-39290871 CTGTAGAAACAGAGACAGTTAGG + Intergenic
1040351226 8:46571152-46571174 TTATATAATCAGAGACAGAGGGG + Intergenic
1041548594 8:59075583-59075605 CCCTATAAGAAAAGACAGATTGG - Intronic
1041734315 8:61093884-61093906 CTGGAGAAGCAGGGACAGACAGG + Intronic
1043055911 8:75438271-75438293 CTGTATAAGAAGAGACAAATAGG - Intronic
1044892996 8:96857068-96857090 CTGTCCAGGCAGAGACTGATGGG - Intronic
1045525689 8:102939783-102939805 CTGTATCATAAGAGCCAGATGGG - Intronic
1047465751 8:125112109-125112131 CTGTATAAGCATACAAACATTGG - Intronic
1047771735 8:128035410-128035432 GTGTGAGAGCAGAGACAGATGGG - Intergenic
1048625554 8:136181261-136181283 CTTTATAAGAAGAGACAATTAGG - Intergenic
1049783637 8:144440248-144440270 CTGTGGACGCAGAGAAAGATGGG + Intronic
1051313754 9:15806563-15806585 CTGTACAAGCAAGAACAGATTGG - Intronic
1054948041 9:70817731-70817753 CTGTAGTAGCACAGAGAGATAGG - Intronic
1055093659 9:72388306-72388328 CTTTATAAGAAGAGAAAGAGAGG - Intergenic
1057307531 9:93920905-93920927 CTGGATATGCGGAGACAGAGAGG - Intergenic
1057940071 9:99274164-99274186 GTGTCCAAGCAGAGACTGATTGG + Intergenic
1058787574 9:108405363-108405385 CTGTCAATGCAGAGACAGAATGG + Intergenic
1058984400 9:110197808-110197830 CTGTGTAAACACAGACAGAAGGG + Intronic
1059032312 9:110712013-110712035 CTGTGCAAACAGAGCCAGATTGG - Intronic
1059757629 9:117308638-117308660 CTGGATAAGAAGAGAAAGTTTGG + Intronic
1060543583 9:124447900-124447922 CTGTAGAAGAAGAAACAGAGTGG + Intergenic
1060906891 9:127314693-127314715 ATGTATGAGGAGAGACAGAGTGG + Intronic
1061804842 9:133132169-133132191 ATGTAGAAGCACACACAGATGGG + Intronic
1185663538 X:1745988-1746010 CTGTAGGAGCAGAGACATGTCGG + Intergenic
1192002415 X:67168110-67168132 TTGTATAAGCAGAGAAAGAAAGG - Intergenic
1193337744 X:80310646-80310668 CTGAATAAGCAGTCACAGACTGG + Intergenic
1193569590 X:83126869-83126891 CTCTATAAACATAGACAGTTGGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194149486 X:90305954-90305976 GTATTTAAGCAGAGACAAATGGG - Intergenic
1195502226 X:105614649-105614671 TTGTATAAGGAGAGAGATATGGG - Intronic
1195674260 X:107495590-107495612 CCGTATATACAGAGACACATGGG + Intergenic
1197630572 X:128853085-128853107 TTGTATAAGTGGTGACAGATAGG - Intergenic
1198229121 X:134672994-134673016 CAGTTTAAGCAGACACAGAGGGG - Intronic
1198342960 X:135732647-135732669 CTTTAAAAGCAGACAGAGATGGG + Intergenic
1198345029 X:135750648-135750670 CTTTAAAAGCAGACAGAGATGGG - Intergenic
1199748393 X:150791258-150791280 CTGTCTAAGCAGACAGAGATAGG - Intronic
1200495861 Y:3882689-3882711 GTATTTAAGCAGAGACAAATGGG - Intergenic
1200679746 Y:6195920-6195942 CTGAATAATCAGAGACAAAAAGG - Intergenic
1200683141 Y:6236280-6236302 CTTTAGAAGCAGAGACTGAAAGG - Intergenic
1201049491 Y:9918106-9918128 CTTTAGAAGCAGAGACTGAAAGG + Intergenic