ID: 1140395167

View in Genome Browser
Species Human (GRCh38)
Location 16:74620199-74620221
Sequence CTGCTAGTTTCTTTGAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140395167_1140395170 -1 Left 1140395167 16:74620199-74620221 CCTGGATTCAAAGAAACTAGCAG No data
Right 1140395170 16:74620221-74620243 GGAAGCCAGCAGACAAGTCTGGG No data
1140395167_1140395169 -2 Left 1140395167 16:74620199-74620221 CCTGGATTCAAAGAAACTAGCAG No data
Right 1140395169 16:74620220-74620242 AGGAAGCCAGCAGACAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140395167 Original CRISPR CTGCTAGTTTCTTTGAATCC AGG (reversed) Intergenic
No off target data available for this crispr