ID: 1140407653

View in Genome Browser
Species Human (GRCh38)
Location 16:74721727-74721749
Sequence CTGTGAAGTAGGAAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 1, 2: 2, 3: 28, 4: 284}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140407653_1140407664 4 Left 1140407653 16:74721727-74721749 CCACCCAGCTTCCTACTTCACAG 0: 1
1: 1
2: 2
3: 28
4: 284
Right 1140407664 16:74721754-74721776 GAGAGGCCCTGGGGTTGGGGAGG 0: 1
1: 0
2: 8
3: 127
4: 953
1140407653_1140407661 -1 Left 1140407653 16:74721727-74721749 CCACCCAGCTTCCTACTTCACAG 0: 1
1: 1
2: 2
3: 28
4: 284
Right 1140407661 16:74721749-74721771 GAGAAGAGAGGCCCTGGGGTTGG 0: 1
1: 1
2: 7
3: 71
4: 657
1140407653_1140407659 -6 Left 1140407653 16:74721727-74721749 CCACCCAGCTTCCTACTTCACAG 0: 1
1: 1
2: 2
3: 28
4: 284
Right 1140407659 16:74721744-74721766 TCACAGAGAAGAGAGGCCCTGGG 0: 1
1: 0
2: 1
3: 62
4: 578
1140407653_1140407660 -5 Left 1140407653 16:74721727-74721749 CCACCCAGCTTCCTACTTCACAG 0: 1
1: 1
2: 2
3: 28
4: 284
Right 1140407660 16:74721745-74721767 CACAGAGAAGAGAGGCCCTGGGG 0: 1
1: 1
2: 5
3: 59
4: 508
1140407653_1140407663 1 Left 1140407653 16:74721727-74721749 CCACCCAGCTTCCTACTTCACAG 0: 1
1: 1
2: 2
3: 28
4: 284
Right 1140407663 16:74721751-74721773 GAAGAGAGGCCCTGGGGTTGGGG 0: 1
1: 0
2: 4
3: 54
4: 539
1140407653_1140407658 -7 Left 1140407653 16:74721727-74721749 CCACCCAGCTTCCTACTTCACAG 0: 1
1: 1
2: 2
3: 28
4: 284
Right 1140407658 16:74721743-74721765 TTCACAGAGAAGAGAGGCCCTGG 0: 1
1: 0
2: 4
3: 80
4: 563
1140407653_1140407662 0 Left 1140407653 16:74721727-74721749 CCACCCAGCTTCCTACTTCACAG 0: 1
1: 1
2: 2
3: 28
4: 284
Right 1140407662 16:74721750-74721772 AGAAGAGAGGCCCTGGGGTTGGG 0: 1
1: 1
2: 0
3: 51
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140407653 Original CRISPR CTGTGAAGTAGGAAGCTGGG TGG (reversed) Intronic
900300353 1:1973868-1973890 CGGTGGAGGAGCAAGCTGGGAGG + Intronic
900661979 1:3789294-3789316 CTCTGAGGTTGGAAGCTCGGGGG + Intronic
902332746 1:15738512-15738534 CTGTGTGGTAGGAGGCCGGGAGG + Intronic
902652975 1:17848700-17848722 CTCTGGAGAAGGAAGCAGGGGGG - Intergenic
903002593 1:20276815-20276837 CTGTGACCTTGGATGCTGGGTGG - Intergenic
903707847 1:25300146-25300168 CTGAGAAGTAGGAATCAGTGAGG + Intronic
904335244 1:29793100-29793122 CGGGGAAGTTGGAAGCTGAGAGG - Intergenic
904369734 1:30040757-30040779 CAGTGAAGTTTGAAGCTGGAAGG - Intergenic
904373521 1:30065871-30065893 CTGTTAGTGAGGAAGCTGGGAGG - Intergenic
907015600 1:51009666-51009688 GAGTGAAGCAGGAAGCTGGTGGG + Intergenic
909400683 1:75226275-75226297 CGGTGGAGAAGGAATCTGGGAGG + Intronic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911530351 1:99036661-99036683 CAGTGAAGAAGGAAGATGTGGGG - Intergenic
912513462 1:110203590-110203612 CCAGGAAGCAGGAAGCTGGGTGG - Intergenic
914835119 1:151200169-151200191 CTGAGAAGAAGAAAGATGGGTGG + Intronic
915395889 1:155583803-155583825 CTGTGGACTAGGAAGCAGGCTGG - Intergenic
915411495 1:155704414-155704436 CTGTGGACTAGGAAGCAGGCTGG - Intronic
915759166 1:158293328-158293350 ATGTGAAATAAGAAACTGGGAGG - Intronic
917655626 1:177122673-177122695 CTGTGAAGTGAGAAGCAGTGTGG - Intronic
918076912 1:181177445-181177467 TTGGGAAGCAGGGAGCTGGGAGG + Intergenic
918206626 1:182315306-182315328 ATGTGGACTAGGAAGCTGGAGGG - Intergenic
918300855 1:183202672-183202694 TTGGGAAGTAGTAAGATGGGTGG - Intronic
920159816 1:203987958-203987980 TTGAGAAGGAGGAAGCTGTGAGG + Intergenic
921135527 1:212256030-212256052 CTGTGAGGCAGGGACCTGGGAGG - Intergenic
922447416 1:225709135-225709157 CTGTGAAGTAGGAGGTAGGGGGG + Intergenic
922504674 1:226119639-226119661 CTGTAATGAAGGCAGCTGGGTGG + Intergenic
923762391 1:236858662-236858684 CTGTGAAAATGGAAGCAGGGTGG + Intronic
924354058 1:243151132-243151154 CTGTGAAACAGGAAGCCGTGAGG - Intronic
1063413205 10:5852626-5852648 CTGAGAAGTAAGAGGCAGGGAGG + Intergenic
1064326315 10:14354619-14354641 TTGTAAAGTAGGGGGCTGGGGGG - Intronic
1065707006 10:28479574-28479596 CTGTGACATAGCAAGCTGGCTGG - Intergenic
1065932432 10:30491481-30491503 CTGTGCAGGAAGAAACTGGGTGG + Intergenic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1068273382 10:54759076-54759098 CTGAGAAGTAGTAAGATGGAGGG - Intronic
1070503438 10:77092635-77092657 CAGTGCAGGAGGAAGCTGAGAGG + Intronic
1070685341 10:78476356-78476378 ATGAGAAGTAGGAGGCGGGGAGG - Intergenic
1072032130 10:91530951-91530973 GAGAGAAGTAAGAAGCTGGGTGG - Intergenic
1074289052 10:112124550-112124572 ATGTTGAGTAGGAAGCTGTGAGG - Intergenic
1075077931 10:119363686-119363708 CTGGGAAGAGGGAAGCTGGGAGG + Intronic
1075907376 10:126093484-126093506 CTCTGAAGTCGGTAGCTTGGGGG - Intronic
1076107339 10:127834257-127834279 CTGGGCAGGAGGAAGCTGGAGGG - Intergenic
1076195143 10:128512441-128512463 CTGTAAACTTGGAAGCAGGGAGG + Intergenic
1076854305 10:133108420-133108442 CCGTGGAGAAGGAAGCAGGGAGG + Intronic
1077297978 11:1834924-1834946 CTGTGCAGCAGGAAGCTGAAGGG - Intronic
1077327852 11:1971425-1971447 CTGTGGAGCAGGACGCTGGAGGG - Intronic
1077756378 11:5033236-5033258 CTGTAAAATAGGAAGATAGGAGG + Intergenic
1078277093 11:9859801-9859823 CTGTGTAGTTAGAAGCTGGGTGG + Intronic
1078859228 11:15231991-15232013 CTGTGAGGTAGGAAGGAGGTTGG - Intronic
1082736482 11:56861556-56861578 CTGAGATGGAGGAGGCTGGGTGG - Intergenic
1084529038 11:69716011-69716033 CTCTCAAGTACGAAGCTGAGAGG + Intergenic
1085040095 11:73321964-73321986 CTGTGGAGCAGGAAGCGGGGAGG + Intronic
1087812515 11:102623515-102623537 GTGGGAAGTAGGAGGCTGGAGGG - Intronic
1088241006 11:107773633-107773655 AAGTGATGGAGGAAGCTGGGTGG + Intergenic
1090391731 11:126393306-126393328 ATGTGAGGTGGGTAGCTGGGTGG + Intronic
1091300455 11:134503933-134503955 CTGGGGAGGAGGAGGCTGGGAGG + Intergenic
1202810832 11_KI270721v1_random:26605-26627 CTGTGGAGCAGGACGCTGGAGGG - Intergenic
1091477248 12:787411-787433 CTGTGAAGTAGGTACCTACGTGG - Intronic
1092001243 12:5034046-5034068 CTGTGAGTTAGGAAGCTGTAGGG - Intergenic
1092658933 12:10718299-10718321 ATGTGGAGGAGGAAGGTGGGTGG - Intronic
1095802597 12:46283908-46283930 CTGTGAAGCAGCAGGCTGGAGGG + Intergenic
1096253567 12:50049643-50049665 CTGAGAAGTAGGAAGAGGTGAGG - Intergenic
1097037530 12:56133684-56133706 ATGGGAAATAGGAAGCTGGCAGG + Intronic
1099201812 12:79687198-79687220 TTGGGAGGTAGGAAACTGGGTGG - Intronic
1100420731 12:94430191-94430213 CTGTGATGTTAGTAGCTGGGTGG - Intronic
1101617449 12:106352007-106352029 CTGTGAGGTAGGAAGATAGTAGG - Intergenic
1101996789 12:109531427-109531449 CTGTCAAGTAGGAAGGCTGGTGG - Intronic
1102647589 12:114413943-114413965 CTTTGAGGGAGGAAGATGGGTGG + Intergenic
1104361618 12:128138490-128138512 CTGTGAGGTAGGAAGCTGGGGGG - Intergenic
1105845031 13:24286674-24286696 CAGGAAAGTAGGAACCTGGGAGG + Intronic
1106751886 13:32781076-32781098 CTGATATGAAGGAAGCTGGGTGG + Intergenic
1108642483 13:52395670-52395692 CTGTGAAGAAGCAAGCAGGGAGG + Intronic
1108993448 13:56694251-56694273 CTGGGAAGTATGAAGTTGGCTGG - Intergenic
1111287250 13:86110606-86110628 CTGAGAAGTAGAAAGGTGAGTGG - Intergenic
1112328863 13:98462062-98462084 CTGTGAGGGAGGAGGCGGGGGGG - Intronic
1113768787 13:112895790-112895812 CGGTGAAGTTGGGACCTGGGAGG - Intronic
1114544680 14:23490185-23490207 TTTTGGAGTAGGAAGATGGGGGG - Intronic
1117066875 14:52019829-52019851 CTATGAGGTAGGACGATGGGTGG + Intronic
1117428374 14:55624789-55624811 TTGGGAAGTAGGGAGCTTGGGGG + Intronic
1117868966 14:60177703-60177725 CTGTGAAGTATGCATGTGGGGGG + Intergenic
1118256664 14:64211370-64211392 CTGTGAAGCAGTAACCTGAGAGG + Intronic
1119136385 14:72224813-72224835 TTGTGAAGCAGCAGGCTGGGTGG - Intronic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121063062 14:90934733-90934755 CTGTGAAGCAGACAGCTGGCAGG + Intronic
1121117561 14:91354388-91354410 CTGTGAGGGAGGATGCTGGATGG - Intronic
1121666998 14:95680170-95680192 CTCTGAAGGAGGAAGCTGGCTGG - Intergenic
1121786918 14:96668873-96668895 CTGGGCAGGAGGAAACTGGGAGG + Intergenic
1202843877 14_GL000009v2_random:149001-149023 GTGTGAAGTGGGAAAATGGGGGG + Intergenic
1124824093 15:33076088-33076110 CTGTGACTTCTGAAGCTGGGGGG + Intronic
1125092523 15:35811057-35811079 CAGAGAAGTAGAAAGCTGAGTGG - Intergenic
1125783422 15:42292136-42292158 CTGTGAAATTGGAGGCTGGTGGG + Intronic
1127384946 15:58459842-58459864 CTGTGAAGGAGGAAGCTGAGAGG - Intronic
1127465650 15:59241975-59241997 CTGTGATGTGGGAAGCTGGGAGG + Intronic
1127965815 15:63922160-63922182 CAGTGAGATAGGAAGGTGGGTGG - Intronic
1128330340 15:66751472-66751494 CTGTGAGGTGGCACGCTGGGTGG + Intronic
1130084833 15:80769024-80769046 CTGGGAAGTAGGCAGGTGGTAGG + Intergenic
1132142058 15:99404575-99404597 GTGGGATGTAGGAGGCTGGGGGG + Intergenic
1133052238 16:3123878-3123900 CTGAGAGGTAGGAGGCTGGAGGG + Intergenic
1133455308 16:5936683-5936705 AGGTGAGGTAGGAAGTTGGGTGG - Intergenic
1133727989 16:8555060-8555082 CTGTGAAGGAGAGACCTGGGAGG - Intergenic
1133742944 16:8665012-8665034 CTGTGAGCGAGAAAGCTGGGTGG + Intergenic
1134487219 16:14668065-14668087 CTGTGAGGAAGGTGGCTGGGTGG - Exonic
1135218557 16:20593557-20593579 CTCAGAAGGAGGAAGGTGGGAGG - Intergenic
1135345737 16:21687050-21687072 ATCTGAAGTAGGAAGTTGGAGGG + Intronic
1136508830 16:30723485-30723507 CTGGGAAATGGGAAGCTTGGGGG + Intronic
1138703126 16:58886082-58886104 CAGTGCAGTAAGAAACTGGGAGG + Intergenic
1140407653 16:74721727-74721749 CTGTGAAGTAGGAAGCTGGGTGG - Intronic
1140588043 16:76317923-76317945 CTGTCAAATGGGAAACTGGGGGG + Intronic
1141054468 16:80803590-80803612 CTGCGAAGGGGGAGGCTGGGTGG - Intronic
1143032987 17:3978031-3978053 CTGTGAAGTGGGAAGCACGGCGG + Intergenic
1143135427 17:4710185-4710207 CTGGGAAGGAGGATGGTGGGGGG - Intergenic
1143341399 17:6214066-6214088 CTGAGAGGTAGGAGGGTGGGGGG + Intergenic
1144421914 17:15106702-15106724 CTGTGAAGAATGAAGGTGGGTGG - Intergenic
1145388526 17:22436230-22436252 CTGTGAATTAGGAAATTGGTAGG - Intergenic
1146072782 17:29699571-29699593 ATGTCAAGTAGAAACCTGGGTGG + Intronic
1146454548 17:32998704-32998726 CTCTAAAGGAGGAAGGTGGGTGG + Intergenic
1146937055 17:36818541-36818563 CTGTGAAGGAGGAAAGTAGGCGG - Intergenic
1147652065 17:42068422-42068444 ATGTGACGTAAGCAGCTGGGGGG - Intergenic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1148634149 17:49134097-49134119 CTGAAAAGGAGGAAGCTGGGAGG + Intronic
1150046495 17:61918617-61918639 TTGTGAATTAGGAGCCTGGGAGG - Intronic
1150707407 17:67499575-67499597 CTGGGCAGTAGGAAGTAGGGAGG - Intronic
1151819093 17:76487696-76487718 CTCGAAGGTAGGAAGCTGGGCGG - Exonic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152314391 17:79571916-79571938 CAGTGAGATAGGACGCTGGGGGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1160048997 18:75414432-75414454 CTCTTAAGTAGGAAGCCGGCAGG - Intronic
1160097428 18:75887886-75887908 CTGTGAATTAGAGAGCTTGGAGG + Intergenic
1160210110 18:76870799-76870821 CTGAGAAGCAGGAAGGTGGCTGG + Intronic
1160408115 18:78656647-78656669 TGGTGCAGTAGGAGGCTGGGTGG - Intergenic
1161045140 19:2130597-2130619 CTGTGGAGGAGGCGGCTGGGAGG - Intronic
1162158533 19:8696032-8696054 CTGTGGAGGAGGGAGTTGGGAGG + Intergenic
1162837896 19:13333340-13333362 ACGTGAAGAAGGAAGCTGTGGGG - Intronic
1162876846 19:13626805-13626827 CTGGGAGGTGGGAAGCGGGGAGG + Intergenic
1163758699 19:19121407-19121429 GTGTGCAGGAGGAACCTGGGGGG + Exonic
1164402324 19:27910751-27910773 CTTTGGAGTTGGAGGCTGGGGGG + Intergenic
1164578910 19:29422297-29422319 CCCTGAAGAAGGCAGCTGGGGGG - Intergenic
1165860850 19:38908580-38908602 CTGAGAGCTAGGAAACTGGGAGG + Intronic
1166719136 19:44987549-44987571 CTGTGGAGAAGGGACCTGGGAGG - Intronic
1168108507 19:54179112-54179134 CTGTAGGGTAGGAAGGTGGGTGG + Intronic
1168427826 19:56253073-56253095 CTGTGGACTTAGAAGCTGGGAGG + Intronic
1168531182 19:57130654-57130676 CTGTGATGTATGAAGATGGAGGG + Exonic
925351149 2:3201395-3201417 GAGTGAAATAGGAAGGTGGGAGG - Intronic
925410544 2:3637425-3637447 CTGTGATGTAGGAAGGAGGGCGG + Intronic
925878290 2:8330174-8330196 TTGTGAAGTACACAGCTGGGAGG + Intergenic
926007665 2:9385083-9385105 CTGTGAAGTAGGCAGAGGGGCGG + Intronic
926046610 2:9714725-9714747 ATGTTAAGTGGGCAGCTGGGTGG + Intergenic
926121677 2:10244511-10244533 CTGTGAAGGAGTAAGCCGAGGGG - Intergenic
927012926 2:18924691-18924713 CTCTGAAGAAGCAAACTGGGTGG + Intergenic
928448147 2:31351124-31351146 CTGGGAAATAGGAAGCTGGTAGG - Intronic
930122019 2:47768203-47768225 CTGTAGAGAAGGAAGCCGGGAGG + Intronic
931357467 2:61549662-61549684 CTGTGTAGTTGCAGGCTGGGTGG + Intergenic
932268845 2:70391312-70391334 CTGTGACACAGGAAGCTGAGTGG + Intergenic
933311341 2:80665407-80665429 CTGTGTATTAAGAAGCTGGAGGG + Intergenic
935126075 2:100223991-100224013 CTGTGAAGTGGGCAGTTGGTGGG - Intergenic
936247599 2:110842215-110842237 CTGAGAGCTAGAAAGCTGGGGGG + Intronic
937318244 2:120945529-120945551 CTGGGCAGTGGGAAGCTGTGTGG + Intronic
937320081 2:120955827-120955849 CTGGGAAGTTGAAATCTGGGGGG + Intronic
938655201 2:133424353-133424375 CTGAGTAGTAGCAAGTTGGGTGG - Intronic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
939179233 2:138784632-138784654 CTCTGCAATAGGAAGCTGGTGGG + Intergenic
942901449 2:181124755-181124777 CTGTGAAGGAGGAAGTAGGGGGG - Intergenic
944366063 2:198920665-198920687 CTGAGAAAAAGAAAGCTGGGAGG + Intergenic
944694891 2:202192071-202192093 GTGTGATCCAGGAAGCTGGGAGG - Intronic
945291818 2:208134569-208134591 CTAAGAAGCAGGAAGGTGGGTGG - Intergenic
946704742 2:222447254-222447276 GTGAGAAGTAGGGAGGTGGGTGG - Intronic
946814588 2:223563800-223563822 CAGTGAAGTTGGAAGCTAGGAGG - Intergenic
1172391299 20:34567177-34567199 CTGGGATCCAGGAAGCTGGGAGG + Intronic
1172988029 20:39008887-39008909 CAGGGAAGGAGGAAGCAGGGTGG - Intronic
1173466410 20:43285528-43285550 CAGTGAAGTAGGAGACTGGCTGG - Intergenic
1174404278 20:50293687-50293709 GGGTGAAGGAGGAAGCTGTGGGG - Intergenic
1175489912 20:59372965-59372987 GTGTCAAGTAGGAGGATGGGGGG - Intergenic
1175498065 20:59428884-59428906 CAGTGAAGTGGGAACATGGGAGG + Intergenic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175950432 20:62580691-62580713 CTGTGGAGCAGGGAGGTGGGAGG + Intergenic
1177031579 21:15986484-15986506 CTGTAAGGAAGGAAGCTGGAAGG - Intergenic
1177209339 21:18050662-18050684 GTGTGAAGGAGAAAACTGGGAGG + Intronic
1179098263 21:38334933-38334955 CTGTGAAGGAGGAATGGGGGTGG - Intergenic
1179433717 21:41345132-41345154 CTGTAAAGTAGGAAGTGGGCAGG + Intronic
1180764178 22:18234098-18234120 CTGGGAAGGTGGAATCTGGGAGG + Intergenic
1180771464 22:18390443-18390465 CTGGGAAGGTGGAATCTGGGAGG - Intergenic
1180802846 22:18640058-18640080 CTGGGAAGGTGGAATCTGGGAGG - Intergenic
1180833090 22:18915963-18915985 CTGGGAAGGCGGAATCTGGGAGG + Intronic
1181066735 22:20310291-20310313 CTGGGAAGGCGGAATCTGGGAGG - Intergenic
1181218872 22:21355203-21355225 CTGGGAAGGTGGAATCTGGGAGG + Intergenic
1181775850 22:25159662-25159684 CTGTAAAATGGGAAGCTTGGAGG - Intronic
1182090068 22:27588513-27588535 GTTTGACGTAGGAAGCAGGGGGG - Intergenic
1182655231 22:31884748-31884770 ATGTCAAGTAGGTAGCTGGAGGG - Intronic
1203233303 22_KI270731v1_random:131434-131456 CTGGGAAGGTGGAATCTGGGAGG - Intergenic
1203283174 22_KI270734v1_random:141267-141289 CTGGGAAGGCGGAATCTGGGAGG + Intergenic
949980071 3:9496936-9496958 ATGTGAAGTACGAGGCAGGGAGG - Intergenic
954109754 3:48427492-48427514 CTGAGAAGTTGGGAGTTGGGAGG - Intronic
955123461 3:56085296-56085318 GTGAGAAGGATGAAGCTGGGAGG + Intronic
956121617 3:65971743-65971765 GTGTCAGGCAGGAAGCTGGGAGG - Intronic
959974605 3:112444605-112444627 CTGGGATGTAGCAAGCTGCGGGG + Intergenic
961751934 3:129101694-129101716 CCGTGAAGAAGGAAACTGGGAGG + Intronic
962250282 3:133832020-133832042 CTCTGAATTAAGGAGCTGGGAGG + Intronic
962293257 3:134155135-134155157 GGGTGAAGAAGGAAGCGGGGAGG - Intronic
962346550 3:134623329-134623351 CTGTGAATGAGGAAAGTGGGTGG - Intronic
963666478 3:148194579-148194601 CTGTGAGAGAGGAAGCTGGTTGG + Intergenic
964201123 3:154120842-154120864 CTCTGAAGAGGGAAACTGGGTGG - Intergenic
966471626 3:180295947-180295969 CTGAGAAGTATGCAGCTGTGTGG + Intergenic
967173526 3:186842762-186842784 CTGTGAAGTTCCAGGCTGGGTGG + Intronic
967254789 3:187578962-187578984 CAGTGAAGTAAAAAGCTGTGGGG + Intergenic
967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG + Intergenic
968726641 4:2250958-2250980 CAGTGCAGCAGGGAGCTGGGAGG + Intronic
968782421 4:2593171-2593193 CTGTGAAGGAGCCAGCTGTGAGG - Intronic
971141184 4:23926603-23926625 CTTGGAAGTAGGAAGCAGGGAGG - Intergenic
972928109 4:44037646-44037668 CTGGGAAGTAGTTAGGTGGGTGG - Intergenic
973274131 4:48291182-48291204 CTGAGAAGGATTAAGCTGGGTGG + Intergenic
973791145 4:54379265-54379287 CTGAGAAGATGGAATCTGGGAGG - Intergenic
975714099 4:77189185-77189207 CTGTGGAGGAGGAAACAGGGAGG - Intronic
978964983 4:114729574-114729596 CTGTGAAGCAGTAACCTGGCTGG + Intergenic
979621808 4:122806492-122806514 CAGTGAAATAAGAAGCAGGGGGG + Intergenic
979771678 4:124532983-124533005 TTGTGAGGATGGAAGCTGGGAGG - Intergenic
979970644 4:127130586-127130608 CTCAGAAGTAGGAAACAGGGCGG + Intergenic
982795516 4:159639088-159639110 CTTTGAAGTAGGAAACATGGAGG + Intergenic
983884380 4:172963901-172963923 CTTTTAAGTAGGAAGCTGGTAGG - Intronic
984641745 4:182173629-182173651 CTGTGAAGAATGAAGTTTGGAGG + Intronic
984766392 4:183403646-183403668 TTGGGAAGCAGGCAGCTGGGCGG + Intergenic
984869059 4:184310951-184310973 CTTTGCTGGAGGAAGCTGGGAGG - Intergenic
984884801 4:184440697-184440719 CTGTGAAGCTGGAGGCAGGGAGG - Intronic
985988292 5:3535646-3535668 CTGAGAAGTCCGAGGCTGGGTGG - Intergenic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
987195945 5:15526209-15526231 GTGTGATGCAGGAGGCTGGGTGG + Intronic
987968220 5:24905149-24905171 TTGAGCAGTAGGAAGCTGAGGGG - Intergenic
989206988 5:38819527-38819549 CTATGAGCTAGGAAACTGGGTGG - Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
991319427 5:65353362-65353384 CTGGGAAGTAGTAAACTTGGTGG + Intronic
992154150 5:73938472-73938494 CAGTGAATGAGGCAGCTGGGAGG - Intronic
995797541 5:115957742-115957764 CTGTGAAGTAGGAGGCAAGGGGG + Intergenic
999399573 5:151253836-151253858 AAGTGAAGGAGGAAGCTTGGAGG - Intronic
1000596420 5:163219748-163219770 CTGTGAAAGAGGAAGCTGCTGGG + Intergenic
1001742805 5:174067890-174067912 CACTGAGGTAGGGAGCTGGGGGG + Intronic
1002077944 5:176720392-176720414 CTTTGACGTAGGAATTTGGGGGG + Intergenic
1002343646 5:178533138-178533160 CTGAGAACTAGGAAGCTCTGAGG + Intronic
1002565794 5:180112551-180112573 CCTTGGAGTTGGAAGCTGGGTGG + Intronic
1002773215 6:307031-307053 GTCTGCAGTAGGCAGCTGGGTGG + Intronic
1003068014 6:2919687-2919709 CAGTGAAGAAGGAAGATGGGAGG + Intergenic
1003347943 6:5288023-5288045 CTGGGAACAAGGCAGCTGGGAGG - Intronic
1004007932 6:11654028-11654050 CTGTAAAGGAGGAAGCTGCTGGG + Intergenic
1004167564 6:13270389-13270411 CTGGGAAGCAGGAGGGTGGGGGG - Intronic
1005038252 6:21577128-21577150 CTGAGAGGTAGGAGCCTGGGAGG + Intergenic
1005952231 6:30640512-30640534 CTGTGAGGAAGGAAGCGGCGGGG - Intronic
1007013804 6:38442612-38442634 CTGTGAAGAAGGAAAGTTGGAGG + Intronic
1007263341 6:40579119-40579141 CTGTGAATGAGGATGCTGGCAGG - Intronic
1007825189 6:44594855-44594877 CTGTGAGGACTGAAGCTGGGAGG + Intergenic
1008528889 6:52435898-52435920 CTGAGAAGTAGCAAGATGTGTGG + Intronic
1012448121 6:99327588-99327610 GTGTGGAGTAGGAAGATAGGAGG - Intronic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1015619737 6:135118512-135118534 CAGTGCAGTTGGAAGCTGGTTGG - Intergenic
1016319893 6:142831193-142831215 CTGAGAAGTAAGGAGCTGAGGGG + Intronic
1016892323 6:149018961-149018983 CAGTGGAGCAGGATGCTGGGAGG + Intronic
1017243981 6:152201984-152202006 TTTTGATGTAGGAAACTGGGGGG + Intronic
1017399109 6:154039317-154039339 CTGTGAACTACTAAGGTGGGAGG + Intronic
1017436282 6:154418504-154418526 CTGTGAGGTGGGAGCCTGGGAGG - Intronic
1019064945 6:169288689-169288711 CTCTGGAGTAGGAGGCTGTGTGG + Intergenic
1019093083 6:169556160-169556182 CTGTGAGGTAGGAGCCTTGGGGG + Intronic
1019208955 6:170389056-170389078 CTGAGAAGGAGGAAGAGGGGTGG + Intronic
1019501187 7:1365489-1365511 GTGTGCAGCAGGAAGCTGGCAGG - Intergenic
1021801534 7:24311595-24311617 CTGGAAGGGAGGAAGCTGGGGGG + Intergenic
1021895463 7:25230961-25230983 CTGTCTGGTAGGAAGCTGAGTGG - Intergenic
1022044859 7:26614547-26614569 ATGTGAAACAGGAAGCCGGGAGG + Intergenic
1022305842 7:29146105-29146127 CGGGGAAGTACGAAGCTGTGGGG - Intronic
1022811135 7:33870038-33870060 CTGTGAAGTGGGCAGCAGAGTGG - Intergenic
1022886721 7:34654332-34654354 GTATGAAGCAGGAAGCTGGGGGG + Intergenic
1023347467 7:39286130-39286152 CTGGGAAGTGGGAAGTGGGGAGG + Intronic
1023659046 7:42454632-42454654 TTGGGAAGTAGGAGACTGGGAGG + Intergenic
1023659501 7:42457935-42457957 CTGGGAAATAGGAGACTGGGAGG + Intergenic
1029250363 7:99232239-99232261 CTGTAAAGTGGGTGGCTGGGTGG - Intergenic
1030884913 7:114924515-114924537 CTGTGCATTAGGATGCTGGATGG + Intronic
1031601825 7:123719430-123719452 CTGTGAAGTCCTAATCTGGGAGG + Intronic
1038405592 8:27320141-27320163 CTGTGAGGTAGGAAGCACGTAGG + Intronic
1038681080 8:29668977-29668999 CTGTCAACTATAAAGCTGGGGGG - Intergenic
1039011986 8:33104002-33104024 CTGCAATGTAGGAAGCTTGGAGG - Intergenic
1039397428 8:37238483-37238505 CTGTGAATATGGAAGCTGAGAGG - Intergenic
1041117708 8:54556076-54556098 CTGCAAAGTAAGGAGCTGGGTGG - Intergenic
1043585477 8:81763821-81763843 CTGAGAAGCAGGAAGGAGGGTGG + Intergenic
1045892218 8:107170467-107170489 CTGGGAAGTCGGGACCTGGGAGG - Intergenic
1048142662 8:131809823-131809845 CTGTGAAGTAGTATGCAGGGAGG + Intergenic
1048899123 8:139021197-139021219 CTTTGATGTAGGAAGATGGCAGG + Intergenic
1048934008 8:139340347-139340369 CTGTGTAGGAGTAAGCTGGCTGG - Intergenic
1049037461 8:140087525-140087547 CTGAGATGGAGGAAGCTCGGTGG - Intronic
1049186267 8:141255767-141255789 ATGAAAAGTAGGAGGCTGGGTGG + Intronic
1049238363 8:141524186-141524208 CTGTGAAATGGGAGGCTGTGGGG + Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1051331889 9:16032137-16032159 CTGTGAGGGAGGAAGGTGGCAGG + Intronic
1052179716 9:25509551-25509573 CTGAGAAGTAGTAAGCTCTGAGG + Intergenic
1052501576 9:29298575-29298597 CTGTGAGGTAAGAAGCAGTGGGG + Intergenic
1055758602 9:79582121-79582143 TTTTGAAGGGGGAAGCTGGGAGG + Intronic
1057186588 9:93060487-93060509 CTGTGAAGTTAGAGGCTGGGGGG + Intronic
1059160580 9:112031110-112031132 CACTGGAGTAGAAAGCTGGGTGG - Intergenic
1059470019 9:114497872-114497894 CTGGGAAGGAGGCAGGTGGGAGG + Intronic
1059520725 9:114939289-114939311 CTATGAAATAGGAAGCTTGGTGG + Intergenic
1060231720 9:121830409-121830431 CTGTGCAGTGGGGAGCAGGGAGG - Intronic
1062028249 9:134350425-134350447 CTGTGAAGTAGCCACCTGCGTGG + Intronic
1186655356 X:11605978-11606000 CTGTGAGAGAGGAAGCTAGGTGG + Intronic
1187425640 X:19175284-19175306 CTGTGGCTTAGGAACCTGGGTGG - Intergenic
1187478540 X:19633799-19633821 CTGTGAACTAGGAAGAGGGTGGG - Intronic
1188202450 X:27308288-27308310 TTTTGTAGTAGGGAGCTGGGAGG - Intergenic
1191798615 X:65052458-65052480 CTGGGAAGTAGGGTTCTGGGGGG - Intergenic
1193657909 X:84220920-84220942 CTCTGAAGTAAGAAGCAGAGGGG + Intergenic
1194363825 X:92988942-92988964 CTGTTAAGAAAGAAGCTGGATGG - Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1196121227 X:112053043-112053065 CACTGAAGTATGAAGCTGAGGGG + Intronic
1196514974 X:116599487-116599509 CAGTGAAGCAGGAAGATGGGGGG - Intergenic
1196937987 X:120748685-120748707 CTCTGAAGGGGGAGGCTGGGAGG + Intergenic
1197571317 X:128154163-128154185 CTCAGAAGTAGGAGGGTGGGAGG + Intergenic
1198448201 X:136739723-136739745 CTGTGAAGTAGGCAAGTGAGTGG + Intronic
1198487465 X:137102717-137102739 CTGTCAAGAAAGAAGCTGAGAGG - Intergenic
1199276341 X:145947577-145947599 CTGAGAAATTTGAAGCTGGGAGG - Intergenic
1199458309 X:148054227-148054249 CTGTGAAATAGGAAGGTGCATGG + Intergenic
1199689692 X:150299177-150299199 CTATGAAGGAGGAAACTGAGTGG + Intergenic
1200096404 X:153666162-153666184 CTGTTAAGTGGGAACCAGGGAGG - Intergenic
1200208107 X:154332508-154332530 CTGGGGAGTAGGAAGCTGCCAGG - Intergenic
1200672057 Y:6105179-6105201 CTGTTAAGAAAGAAGCTGGATGG - Intergenic