ID: 1140409012

View in Genome Browser
Species Human (GRCh38)
Location 16:74730160-74730182
Sequence AGCAGGGGGGTGGGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 688
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 624}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140409002_1140409012 -8 Left 1140409002 16:74730145-74730167 CCATCACAGCCTGGGAGCAGGGG 0: 1
1: 0
2: 1
3: 61
4: 436
Right 1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 60
4: 624
1140409000_1140409012 -7 Left 1140409000 16:74730144-74730166 CCCATCACAGCCTGGGAGCAGGG 0: 1
1: 0
2: 4
3: 32
4: 295
Right 1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 60
4: 624
1140408990_1140409012 27 Left 1140408990 16:74730110-74730132 CCCCCCAGCTGCTCTGGAGGTGG 0: 1
1: 0
2: 4
3: 59
4: 493
Right 1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 60
4: 624
1140408993_1140409012 25 Left 1140408993 16:74730112-74730134 CCCCAGCTGCTCTGGAGGTGGAG 0: 1
1: 0
2: 29
3: 546
4: 5132
Right 1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 60
4: 624
1140408994_1140409012 24 Left 1140408994 16:74730113-74730135 CCCAGCTGCTCTGGAGGTGGAGC 0: 1
1: 3
2: 56
3: 1587
4: 26904
Right 1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 60
4: 624
1140408992_1140409012 26 Left 1140408992 16:74730111-74730133 CCCCCAGCTGCTCTGGAGGTGGA 0: 1
1: 0
2: 7
3: 53
4: 492
Right 1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 60
4: 624
1140408995_1140409012 23 Left 1140408995 16:74730114-74730136 CCAGCTGCTCTGGAGGTGGAGCT 0: 1
1: 4
2: 23
3: 424
4: 5895
Right 1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG 0: 1
1: 0
2: 3
3: 60
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140409012 Original CRISPR AGCAGGGGGGTGGGGGTCCT GGG Intronic
900206678 1:1434685-1434707 AGCTGGGAGGTGGGGGACGTGGG - Intergenic
900265922 1:1757150-1757172 GGCAGGGGGGAAGGGGGCCTGGG - Exonic
900346746 1:2213839-2213861 AGCAGGGGGGTGACTGTCCCCGG + Intergenic
900400702 1:2471824-2471846 AGCAGGCCGGAGGGGGCCCTGGG - Intronic
900563774 1:3322508-3322530 TGGGGGTGGGTGGGGGTCCTGGG - Intronic
900602547 1:3509337-3509359 AGGAGGGTGGTGGGGTTCCCTGG - Intronic
900862278 1:5242144-5242166 AGCAGGGAGGAGGGGGGTCTGGG + Intergenic
900887875 1:5428247-5428269 TGAAGGGGGGTGGGGGACCATGG + Intergenic
900965576 1:5956056-5956078 AGCTGGGGGGGGGGGGTGCAGGG + Intronic
901032350 1:6314655-6314677 TGCAGGAGGGTGGGGGACCATGG + Intronic
901129028 1:6950702-6950724 GGCTGGGGGGTGGGGGTGCATGG - Intronic
901143782 1:7052076-7052098 GGCGGGGGGGTGGGTATCCTTGG + Intronic
901158279 1:7155158-7155180 AGCAGGGGTGTGGGGGGCTGTGG + Intronic
901405557 1:9042738-9042760 AGCTGGGGGCTAGGGGTCCTGGG - Intronic
901511239 1:9719011-9719033 AGCCTGGGGATGGGGGTCCTGGG + Intronic
901621361 1:10590542-10590564 AACTGGGGGGTAGGGGTCCTAGG + Intronic
901637801 1:10678409-10678431 AGCAGGTGGGTGGGGGTGGGGGG + Intronic
902400220 1:16153343-16153365 AGCAGGGAGGTGGGGACTCTGGG + Intronic
902606859 1:17573757-17573779 AGCACTGGGGAGGGGGCCCTGGG - Intronic
903280852 1:22249043-22249065 GGCAGGGGGGAGGAGCTCCTAGG + Intergenic
903653400 1:24934428-24934450 AGCAGGGTGGTGAGGGTGTTAGG + Intronic
903745510 1:25584232-25584254 CGCAGGGGGTTGGGGGGCATTGG - Intergenic
903811362 1:26036669-26036691 AGCTGGGGGGTGGGGGTGGAAGG - Intergenic
903925492 1:26827882-26827904 AGCAGGGGGGCCAGGGGCCTGGG - Intronic
904010212 1:27385154-27385176 TGCTGGGGGGTGGGGGGCTTGGG + Intergenic
904054141 1:27659249-27659271 AGCTGGGGGGTGGGGAGCATGGG + Intergenic
904295871 1:29519454-29519476 AGCAGGAAGGTTGGGGTCCAGGG - Intergenic
904336576 1:29801961-29801983 AGCAGGAAGGTTGGGGTCCTAGG - Intergenic
904598077 1:31659135-31659157 AGCTGAGGCCTGGGGGTCCTGGG + Intronic
904688032 1:32274663-32274685 AGCAGGGGGGAAGGGGGCCAGGG + Intronic
904708810 1:32412954-32412976 AGTAAGGGGATGGGAGTCCTTGG + Intergenic
904762138 1:32813101-32813123 AGAAAGGGGGTGGGGGTTCTAGG - Intronic
905422891 1:37860162-37860184 AGAAGGGAGCTGGGGGTCCTAGG - Intergenic
905544159 1:38784483-38784505 AGCAGTGGGGTGTGTGACCTTGG - Intergenic
905806348 1:40880372-40880394 AGCAGTGGGGTGGGGAGGCTGGG + Intergenic
905823847 1:41014843-41014865 AGCAGGGGAGTGGCAGTGCTGGG + Intergenic
905923783 1:41735892-41735914 AGCAGGAGGGTGGGGGCTCTGGG + Intronic
906034319 1:42741086-42741108 AAGAGGGAGGTGGGGGTGCTCGG - Intergenic
906207643 1:43995690-43995712 AGCAGGAGGCTGGGTGTTCTGGG - Intronic
906326159 1:44847414-44847436 AGGAGGGAAGTGGGGGTCCTGGG + Intergenic
906408641 1:45561931-45561953 AGTATGGGGGTGGGGCTGCTAGG - Intronic
906478856 1:46187476-46187498 AGCAAGGGGGTGGTGGTTCTGGG - Intergenic
907097979 1:51799343-51799365 TGTTGGGGGGTGGGGGTGCTGGG - Intronic
907237896 1:53063869-53063891 AGCATGGCGGTGGAGGCCCTTGG + Intronic
907326957 1:53644575-53644597 AGTAAGGGGATGGGGGTGCTGGG + Intronic
907882509 1:58564534-58564556 AGCAAGGGCATGGGAGTCCTCGG + Intergenic
908179459 1:61589414-61589436 GGCTGGGGGCTGGGGGTCTTCGG + Intergenic
909103171 1:71376530-71376552 AGCAAGGGTATGGGAGTCCTCGG - Intergenic
912950649 1:114118186-114118208 AGCAGGGGGAAGGGAGGCCTGGG - Intronic
913278700 1:117164351-117164373 GGCAGGGGGGTGGGGTTGCGGGG + Intronic
913302573 1:117387950-117387972 CGGCGGGGGGTGGGGGGCCTTGG - Intronic
914346060 1:146799437-146799459 AGGATGGGGGTGAGGTTCCTAGG - Intergenic
914800778 1:150960893-150960915 ATCTGGGGGGTGGGAGTCCTTGG - Exonic
915228779 1:154430435-154430457 AGCAGGCGGGCGGGGATCCTGGG - Intronic
915302047 1:154957253-154957275 AGCAGCGGGGTGGGGGTGGGGGG + Exonic
915303917 1:154967169-154967191 TGTAGGGGGGTGGGGGGCCGGGG + Intronic
915310577 1:155004069-155004091 GGCAGGGGGGCGGGGAGCCTGGG + Intronic
915321672 1:155059977-155059999 AGCATGGGGGTGGGGGACAGGGG + Intronic
915326903 1:155085456-155085478 AGCCGGGGGGTGGAGCCCCTAGG + Intronic
915340946 1:155176276-155176298 TGCAGGTGGGTGGGGGTGCCTGG + Intronic
915561875 1:156692515-156692537 AGGAGGGGGAGGGGGCTCCTAGG + Intergenic
915931257 1:160062209-160062231 AGCACGGGGGAGTGGGCCCTGGG - Intronic
917025019 1:170631847-170631869 GGGACGGGGGTGGGGGTCCGGGG - Intergenic
917531910 1:175843160-175843182 GGGAGGGGGGTGGGGTTGCTGGG + Intergenic
918004516 1:180529222-180529244 TGCAGGGAGCTGGGTGTCCTTGG + Intergenic
918941445 1:191003858-191003880 AGCAGTGGAGTGGGGGTCAGTGG - Intergenic
919749239 1:201026232-201026254 AGCATGGGGGTGGGGGAGATAGG - Intergenic
919758942 1:201084907-201084929 AGCTGGGGGTTGGGGGTTCCTGG + Intronic
919805921 1:201380982-201381004 AGCATGGGGGTGGGGGTTGGAGG + Exonic
919820609 1:201469490-201469512 AGCAAGGGGGTGGGCTTGCTTGG + Intergenic
919986889 1:202681729-202681751 GGCAGGGGAGTGGGGATGCTTGG - Intronic
920049369 1:203154051-203154073 AGCAGGGAGGTGGAGGGCCGGGG - Intronic
920215570 1:204359744-204359766 AGCTGGGGGGAGGGGTGCCTTGG - Exonic
921213368 1:212918125-212918147 TGCAGAGGGGTGGGTGTGCTGGG + Intergenic
922705502 1:227788266-227788288 GGCAGGGTGGGCGGGGTCCTGGG + Intergenic
922725823 1:227922583-227922605 TGCAGGGGAGAGGGGCTCCTGGG + Intronic
923936436 1:238765346-238765368 AGCTGGGGGTGGGGGGTACTTGG + Intergenic
923958467 1:239049746-239049768 AGCAAGGGTGTGGGAGTCCTTGG - Intergenic
924517639 1:244779895-244779917 AACAGAGGGGTGGAGGTTCTGGG - Intergenic
1062789500 10:292902-292924 TGCCAGGGGGTGGTGGTCCTAGG - Intronic
1063574057 10:7245140-7245162 GGCAGGGATGTTGGGGTCCTGGG - Intronic
1065797613 10:29321769-29321791 AGCAGGGGTGTGGGGGAAGTGGG - Intergenic
1066602862 10:37126076-37126098 AGTCGGGGGCTGGGGGGCCTGGG + Intronic
1067455979 10:46419552-46419574 AGCAGGGGGGATGGGGATCTGGG - Intergenic
1067631221 10:47965087-47965109 AGCAGGGGGGATGGGGATCTGGG + Intergenic
1067682792 10:48451009-48451031 CGCAGTGGGGTGGGGCTCCGAGG - Exonic
1069947657 10:71998902-71998924 TGCAGGGGGGTGGAGGTGGTGGG + Intronic
1070796740 10:79221365-79221387 AGCTGGGGGCTGGGCGTCCAGGG - Intronic
1070813170 10:79308447-79308469 AGCACGTGGCTGGGGGTCCTGGG + Intronic
1070828248 10:79403661-79403683 AGAAGAGGGGAGGGGGCCCTGGG - Intronic
1071295238 10:84214654-84214676 AGCAGGGTGGTGGGGGTCAGGGG - Exonic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1072219606 10:93316333-93316355 GGCGGGGGGGTTGGGGACCTTGG + Intronic
1072913224 10:99521743-99521765 AGAAGAGGGGTAGGGGTCCCGGG + Intergenic
1074185848 10:111098886-111098908 AGCAGGAGGCTCTGGGTCCTTGG - Intergenic
1074596862 10:114876085-114876107 AGCGGGAGGGTGGGGGCCCCGGG - Intronic
1074825927 10:117215950-117215972 AGCATGAGGGCTGGGGTCCTGGG + Intergenic
1074850281 10:117433981-117434003 AGCATGGGGCTGGGGGATCTGGG - Intergenic
1075339329 10:121633003-121633025 GGCAGGGAGGGGGGGGTCCCAGG + Intergenic
1075441971 10:122487182-122487204 AGCAGAGGAGTGCGGGTCCCTGG + Intronic
1075654458 10:124152110-124152132 CGCTGGGCGGTGGGGGTCCTGGG + Intergenic
1075797132 10:125128586-125128608 AGTAGGGAGGTGGGGGTCAAGGG + Intronic
1076379398 10:130014833-130014855 AGCTGGGAGCTGGGGGACCTGGG + Intergenic
1076491512 10:130864853-130864875 AACAGAGGGTTGGGGGGCCTCGG - Intergenic
1076607125 10:131696222-131696244 AGCAGTGGGGTTGGGGTCATAGG + Intergenic
1076761669 10:132608864-132608886 GGCATGGGGGTGTGGGACCTGGG + Intronic
1076849408 10:133085816-133085838 AGCAGCGGGGGAGGGGCCCTGGG + Intronic
1077037311 11:501679-501701 AGCTGGGGGCTGGGAGTCCTCGG - Intronic
1077088237 11:765390-765412 AGGAGGGGGGCGGGGGGCATGGG - Intergenic
1077247142 11:1545140-1545162 GGCAGGAGGGTGGGAGTCCCCGG + Intergenic
1077309965 11:1883950-1883972 ACCAAGGGGCTGGGTGTCCTGGG - Exonic
1077474089 11:2778298-2778320 AGCTGGGGGGAGGGGGCACTTGG - Intronic
1077611473 11:3645566-3645588 AGCAGGTGGGTGGCTGGCCTTGG - Intronic
1077783818 11:5360985-5361007 TGCAGTGGGGTGGGGGTCGGGGG + Intronic
1077872943 11:6278855-6278877 AGCATGTGGATGGGGGTTCTAGG - Intergenic
1078064390 11:8068417-8068439 TGCAGGGGTGTGGTGGTGCTGGG - Intronic
1078673105 11:13382496-13382518 GGCAGGGGGGCGGGGGTCACGGG - Intronic
1079111867 11:17609768-17609790 GGCCTGTGGGTGGGGGTCCTGGG - Exonic
1079762326 11:24344505-24344527 ACCAGGTGGGAGGGGGTCCCTGG - Intergenic
1080441647 11:32299947-32299969 AGCAATGTCGTGGGGGTCCTGGG - Intergenic
1080668225 11:34354486-34354508 AGCTGGGGGGTGGGGGTGGGGGG + Intronic
1080824152 11:35833702-35833724 AGTTGGGGGGTGGGGGGCGTTGG + Intergenic
1082903859 11:58285176-58285198 AGCTGGGAGGTGGGTGGCCTGGG + Intergenic
1083424461 11:62575908-62575930 AGCAGGGAGCTGGGGGAGCTGGG + Exonic
1083641487 11:64148145-64148167 AGCAGGGCCCTGGGGATCCTTGG - Intronic
1083879940 11:65543361-65543383 CCCTGGGGGGTGGGGGTCCTGGG + Intronic
1083886892 11:65577319-65577341 AGCAGGAGGCTGGGGTCCCTTGG + Intronic
1083986552 11:66219498-66219520 CACAGGGGGGTGGAGGACCTGGG + Intronic
1084063509 11:66690404-66690426 AGCCAGGGAGTGGGGGTGCTGGG + Intronic
1084183358 11:67457478-67457500 AGCCTGGGGGTGGGGGTGCCTGG + Intronic
1084234148 11:67775497-67775519 AGCAGGGGGGTGGTGCTGGTTGG + Intergenic
1084471906 11:69367218-69367240 CGGAGGGTGGTGGGGGGCCTGGG + Intronic
1085029046 11:73258565-73258587 GGAAGGGGGCTGGGGGTTCTAGG + Intergenic
1085313540 11:75530175-75530197 GGCAGGCAGGTGGGGGTCCCAGG - Intergenic
1086108883 11:83176681-83176703 AGTCGGGGGGTGGGGGGTCTGGG + Intronic
1086822034 11:91446375-91446397 AGTTGGGGGGTGGGGGTTCCAGG - Intergenic
1086827704 11:91519452-91519474 GGCAGGGGGGTGGGGGGCGGGGG + Intergenic
1088103321 11:106177809-106177831 AGGAGGGGGGTTGGGGGCTTCGG - Intergenic
1088771073 11:113036576-113036598 AGCAGAAGGATGGGGGACCTGGG - Intronic
1089581527 11:119484446-119484468 AGAATGGGGGTGAGGATCCTTGG + Intergenic
1089638606 11:119832449-119832471 AGCATGGGGCTGGGGATCCCTGG + Intergenic
1089643707 11:119864354-119864376 AGCTGGTGGGTGGGGCTCCTGGG - Intergenic
1089648004 11:119892758-119892780 AGCAGGGGGGTGGCCGGCCCAGG - Intergenic
1090227609 11:125081250-125081272 AGCAGGAGGGAGCGGGGCCTGGG - Intronic
1091960712 12:4691809-4691831 AGGATGGGGGGGGGGGTCATGGG + Exonic
1092125748 12:6073971-6073993 AGGGGAAGGGTGGGGGTCCTGGG - Intronic
1092456155 12:8644766-8644788 AGAAGTGGGGAAGGGGTCCTGGG - Intronic
1093146728 12:15575382-15575404 GTCAGGTGGGAGGGGGTCCTTGG - Intronic
1094291647 12:28857201-28857223 TGCTGAGGGGTGGGGGTGCTTGG - Intergenic
1094617143 12:32046154-32046176 AGGTTGGGGGTGGGGGTACTGGG + Intergenic
1094687963 12:32737899-32737921 AGCAGCGGGGGAGGGCTCCTGGG - Exonic
1094722317 12:33077100-33077122 AGCTGGGGGGTGGGTAGCCTGGG - Intergenic
1095180814 12:39144979-39145001 GGGAGGGGGGTGGGGTTCCGCGG + Intergenic
1096152911 12:49325774-49325796 AGTCGGTGGGTGGGGGTTCTGGG - Exonic
1096785813 12:54016646-54016668 AGGGGTGGGGTGGGGGTCCGGGG + Intronic
1098493289 12:71106830-71106852 AGCAGGGAGGGGGTGGGCCTTGG + Intronic
1099505318 12:83468743-83468765 ACCAGAGGGGTGGGGGTCAGTGG + Intergenic
1100309010 12:93377641-93377663 AGCAGGGAGGGAGGGGACCTTGG + Intergenic
1100385219 12:94099738-94099760 GGCAGGGCGGTGGGGGTTGTGGG + Intergenic
1100726728 12:97416870-97416892 AGCTGGGGGGTGGGGGGTGTGGG + Intergenic
1101302414 12:103495685-103495707 GGCAGGGGGGTGGGGGGCCAAGG - Intronic
1101686700 12:107030924-107030946 AGCTGGGGGTTGGGGGTACCTGG + Intronic
1102339086 12:112108093-112108115 AGGCGGGGGGAGGGGGTCTTGGG - Intronic
1102432708 12:112896245-112896267 AGCAGGGGGGTGGGGACTCCAGG + Intronic
1102951867 12:117036588-117036610 GGCAGGGGTGTGGGAGCCCTCGG + Intergenic
1103218250 12:119220420-119220442 AGCAGGGAGGTGGGGGTAACTGG - Intronic
1103404705 12:120667042-120667064 TGCGGAGGGGTGGGGGTCCGGGG - Exonic
1103506043 12:121442890-121442912 GGCAGGGGGGCGGGAGGCCTTGG - Intronic
1103538273 12:121648474-121648496 AGTAGGGAGGTGGCTGTCCTAGG - Intergenic
1103828282 12:123757751-123757773 AGCACGGGGTTGGGGGTGCGGGG + Intronic
1104859086 12:131915434-131915456 CGGAGGGGGGAGGGGGTGCTAGG + Intronic
1105932488 13:25065945-25065967 ATCAGGAGGGAGGGGGTCTTTGG - Intergenic
1106244569 13:27937578-27937600 TGTAGGGGGGTGGGGGGGCTGGG + Intergenic
1108300479 13:49069413-49069435 AGCATGGGGGTGGGGGAACACGG - Intronic
1108344583 13:49532591-49532613 AAAAGGGGGCTGGGGCTCCTAGG + Exonic
1108431916 13:50361894-50361916 GGCAGGGTGGTGAGGGTCCAGGG - Intronic
1108481198 13:50873893-50873915 AGCAGCAGGGTGGGGGTCAGTGG + Intergenic
1108506310 13:51115654-51115676 GGCAGGGAGGTGGGGGTGATGGG + Intergenic
1108899655 13:55385205-55385227 AGCACTGGGGTGTGGGTCCTAGG + Intergenic
1109388728 13:61666723-61666745 ACCAGGTGGGAGGGGGTCCCTGG - Intergenic
1112177622 13:97042555-97042577 AGCAACGGTATGGGGGTCCTTGG - Intergenic
1112506193 13:99977554-99977576 AGCAGGGGGGTGGATTTCATAGG - Intergenic
1112705900 13:102068791-102068813 AGCAGGGGGGTGGTGCTCGTCGG - Intronic
1113324938 13:109271830-109271852 AGCAAGGGCATGGGAGTCCTGGG + Intergenic
1113416479 13:110132370-110132392 AGCAGAGGGGGGTGGGGCCTAGG + Intergenic
1113776966 13:112953380-112953402 AGCTGCGGGGAGGGGCTCCTCGG + Intronic
1114063058 14:19037743-19037765 CGCAGGGGGGCGAGGGTCTTCGG + Intergenic
1117321212 14:54625110-54625132 AGCTGGGGGGAGGGGGACATAGG - Intronic
1117845351 14:59905932-59905954 AGAAGGAGCGTGGGGGTTCTAGG - Intergenic
1118601419 14:67473395-67473417 AGGAAGCGGGTGGGGGGCCTGGG - Exonic
1119010207 14:70977737-70977759 ATCAGAGGGGGTGGGGTCCTTGG - Exonic
1119924409 14:78479182-78479204 AGCAGGTGGGGGAAGGTCCTGGG - Intronic
1120911149 14:89668143-89668165 AGCATCGGGGTGGGGGTCGGCGG - Intergenic
1120970805 14:90205367-90205389 AGCAGGGAGGTGGGAATCCCAGG + Intergenic
1121037201 14:90716154-90716176 AGAAGGAGGGTGGGGGTCAGTGG + Intronic
1121259204 14:92553882-92553904 GGCAGGGCTGTAGGGGTCCTGGG - Intronic
1122330765 14:100910980-100911002 AGCAGTGGGCTGGGCGTCATGGG + Intergenic
1122347086 14:101067386-101067408 AGCATGGGAGTGGGGATCCCTGG + Intergenic
1122826304 14:104372492-104372514 AGCTGGGTGGTGGGGGACCCAGG - Intergenic
1123666802 15:22614600-22614622 AGAAAGGGGCTGGGGGTCCCTGG - Intergenic
1124320642 15:28709173-28709195 AGAAAGGGGCTGGGGGTCCCTGG - Intronic
1124481852 15:30086176-30086198 AGAAAGGGGCTGGGGGTCCCTGG + Intronic
1124488308 15:30138274-30138296 AGAAAGGGGCTGGGGGTCCCTGG + Intronic
1124521741 15:30411025-30411047 AGAAAGGGGCTGGGGGTCCCTGG - Intronic
1124536923 15:30555194-30555216 AGAAAGGGGCTGGGGGTCCCTGG + Intronic
1124543398 15:30607248-30607270 AGAAAGGGGCTGGGGGTCCCTGG + Intronic
1124755219 15:32400046-32400068 AGAAAGGGGCTGGGGGTCCCTGG - Intronic
1124761727 15:32452397-32452419 AGAAAGGGGCTGGGGGTCCCTGG - Intronic
1124776900 15:32596671-32596693 AGAAAGGGGCTGGGGGTCCCTGG + Intronic
1124959930 15:34386531-34386553 AGAAGGGGGCTGGGGGCCCCTGG - Intronic
1124976557 15:34532752-34532774 AGAAGGGGGCTGGGGGCCCCTGG - Intronic
1125632795 15:41161416-41161438 ATCAGGGGGGCGGGGGACGTAGG + Intergenic
1126285329 15:47003793-47003815 GACATGGGGGTGGGGGTACTGGG - Intergenic
1126604244 15:50459975-50459997 AGGGGGGGGGTGGGGGAACTGGG - Intronic
1127453898 15:59140875-59140897 TGCAGGGGGGTGGTGGTGGTGGG - Intronic
1127531798 15:59850725-59850747 AGTTGGGGGCTGGGGGTGCTGGG - Intergenic
1127868980 15:63054377-63054399 AGAATGGGGGTGGGGGTGATCGG + Intronic
1127970024 15:63951310-63951332 TGCAAGGGGGTGCGGTTCCTGGG + Intronic
1128519873 15:68368198-68368220 AGCAGTGGGGTGGGTCTCCCTGG - Intronic
1129125846 15:73440744-73440766 AGCAGGGCCCTGGGTGTCCTTGG + Intergenic
1129272938 15:74428936-74428958 AGCAGGGGGATGGAGGGCCACGG - Intronic
1129666093 15:77580149-77580171 AGCAGGGACTTGGGGGTGCTAGG - Intergenic
1129737722 15:77975304-77975326 AGCATGGAGGCGGGGGCCCTGGG - Intergenic
1129847697 15:78775545-78775567 AACGGGGGGGTGGGGGTGCAGGG - Intronic
1130923083 15:88365392-88365414 GGCAGAGGGGTGGGGGGCCAGGG + Intergenic
1132372288 15:101307389-101307411 TGCAGGGAGGTGAGGGTTCTGGG - Intronic
1132550686 16:552767-552789 ACGAGGTGGGTGGGGGTCCCGGG + Exonic
1132572462 16:649921-649943 AGCGGGGGCGAGGGGGCCCTCGG - Intronic
1132644476 16:992458-992480 GGCAGGGGCCTGGGGGTCCCTGG + Intergenic
1132828445 16:1916418-1916440 AGCCTGGGGGTGGGGTTCCGGGG - Intronic
1132931029 16:2459396-2459418 AGCAGGGGGGCGGGGGTACAGGG - Intergenic
1132993146 16:2807749-2807771 GGCCTGGGGGTGGGGGTCCTGGG - Intergenic
1132993537 16:2810706-2810728 AGCTGTGGGGCTGGGGTCCTAGG + Intergenic
1133069454 16:3235686-3235708 AGTAGGGGGGTGGGGGTTGGGGG - Intronic
1133287804 16:4698601-4698623 TGCAGGGGGGTGGGGGGCGCGGG + Intronic
1133488251 16:6241147-6241169 GGCAGGGGCGTTGGGGTGCTGGG - Intronic
1133679756 16:8109881-8109903 AGTAAGGGTGTGGGAGTCCTCGG - Intergenic
1133699153 16:8293051-8293073 AGCTGGGGGGTGGGGGAGTTGGG + Intergenic
1134040004 16:11061046-11061068 AGCAGGGGGCTGGGGGACATGGG + Intronic
1134160978 16:11889305-11889327 AGAAGAGGGGTGGGGGTGCCGGG - Intronic
1134899199 16:17920079-17920101 AGCTGGGGGGTTGGAGTACTGGG - Intergenic
1134903445 16:17959316-17959338 TACCAGGGGGTGGGGGTCCTTGG - Intergenic
1135920767 16:26647084-26647106 AGGCGGGGGGTGGGGGTCGCTGG - Intergenic
1135949170 16:26896927-26896949 AGCAAGGGGATCAGGGTCCTGGG - Intergenic
1136983718 16:35081699-35081721 AGCAAGAGGCTGGGAGTCCTGGG - Intergenic
1138090987 16:54174471-54174493 AGCACTGGGGTCGGGGTGCTGGG + Intergenic
1139340820 16:66266917-66266939 GGGAGGTGAGTGGGGGTCCTGGG - Intergenic
1139518076 16:67463749-67463771 GGCAGGGTGGGTGGGGTCCTGGG - Intronic
1139987919 16:70915830-70915852 AGGATGGGGGTGAGGTTCCTAGG + Intronic
1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG + Intronic
1140580276 16:76223253-76223275 AGCTGGGGGGTGGGGGGGCAGGG + Intergenic
1140787217 16:78354222-78354244 GGCAGGGGTGGGGGGGTGCTGGG - Intronic
1141161580 16:81632736-81632758 AGCTGGGAGGTGGAGGTCCTAGG + Intronic
1141469283 16:84227890-84227912 AGCAGAGGGGTGGGTGTCCGGGG + Intronic
1141548458 16:84787994-84788016 AGCAGGGAGGTGGAGGGCGTGGG + Intergenic
1141605411 16:85150296-85150318 AGCATGCGGGTGGCAGTCCTAGG + Intergenic
1141667697 16:85474416-85474438 GGGAGGCGGGTGGGGGACCTCGG + Intergenic
1141802810 16:86322703-86322725 ATGATGGGGGTGGGGGTGCTGGG - Intergenic
1142135605 16:88450641-88450663 AGGTGGGGGGTGGAGGTCCTAGG + Intergenic
1142147029 16:88497001-88497023 AGCAGGTGTGTGCGGCTCCTGGG - Intronic
1142148943 16:88504335-88504357 AGAACTGGGGTGGGGGTCCCTGG - Intronic
1142207455 16:88790944-88790966 AGGAGGGGGTTGAGGCTCCTGGG - Intergenic
1142423708 16:89989410-89989432 TGCTGGGGGGTGGGGGTGCAAGG - Intergenic
1142764986 17:2059681-2059703 AGCAGCGGGGTCGGGGTCCTTGG - Exonic
1142878298 17:2865801-2865823 AGAAGGGGGCTGGGGGTCAGAGG - Intronic
1143136750 17:4716534-4716556 TGCAGGCGGGTGGGGGGCCGGGG - Exonic
1143719536 17:8799754-8799776 GGCAGGGGAGTGGGAGTCTTGGG - Intergenic
1143843044 17:9749971-9749993 AAAAGGGGGGTGGGGGTCATAGG - Intergenic
1144613015 17:16741443-16741465 AGCATGGGGGCTGGGGTCCAAGG + Intronic
1144753540 17:17666345-17666367 AGCAGGGGCCCGGGGATCCTGGG - Intergenic
1144764458 17:17725052-17725074 GGCAGGGGGAGGGGGCTCCTGGG + Intronic
1144874437 17:18390143-18390165 TGCTGGGAGGTGGGGGACCTAGG - Intergenic
1144899785 17:18574279-18574301 AGCATGGGGGCTGGGGTCCATGG - Intergenic
1145166025 17:20614107-20614129 AGCAGGGGTGGAGGGGTCCAGGG - Intergenic
1146682143 17:34816093-34816115 AGCAGAGGGCTGGGGGGCCAAGG - Intergenic
1147191370 17:38739971-38739993 AGCAGGGGGGTGGGACTCAGAGG - Intronic
1147403663 17:40195523-40195545 GGGAGGGGGCTGGGGGTCCCTGG - Exonic
1147651085 17:42062435-42062457 ATCTGCGGGGTGGGGGTCCCAGG - Intronic
1149389630 17:56175922-56175944 AGTAGGGGGGTGGGGGAGTTGGG + Intronic
1149422167 17:56521490-56521512 AGCAGGGGGGTGGGGAGCCTGGG + Intergenic
1150289399 17:63972866-63972888 AGAAGGGTGGTGGGTGGCCTGGG + Exonic
1150467138 17:65403253-65403275 AGCTGGGGGGTGGGAGTGGTGGG - Intergenic
1151381657 17:73729971-73729993 AGCAGGGGGAAGGAGGACCTAGG + Intergenic
1151748401 17:76023687-76023709 AGCAGGGGTGTGGGGGCTCTGGG - Intronic
1151766971 17:76137741-76137763 AGCAGGGTGCTGGGGGGCCGCGG + Exonic
1151884435 17:76915320-76915342 TGCAGCGGGGTGGGGGGCCTGGG + Intronic
1151892211 17:76957415-76957437 TGCTGGGGGGTGGCTGTCCTTGG + Intergenic
1152065907 17:78112432-78112454 GGCTGGGGGGTGGTGATCCTGGG - Exonic
1152302785 17:79505238-79505260 AGCGGGGGTGTGGTGGGCCTGGG - Intronic
1152549902 17:81024050-81024072 AGCAGAGTGGTGGGGGCCCAAGG + Intergenic
1152583484 17:81179166-81179188 AGGAGGGGGGTGTGGGTCTCTGG + Intergenic
1152794885 17:82301944-82301966 AGCAGGGAGGTTGGGGCCCACGG + Intergenic
1153121433 18:1732177-1732199 AGCAAGGGCATGGGAGTCCTCGG + Intergenic
1153763984 18:8357521-8357543 TGCAGTAGGGAGGGGGTCCTTGG + Intronic
1154451022 18:14474901-14474923 CGCAGGGGGGCGAGGGTCTTCGG - Intergenic
1156474647 18:37397884-37397906 GGCAAGGGGGTGCGGATCCTTGG + Intronic
1156881669 18:42087619-42087641 AGCAAGGGTATGGGAGTCCTCGG - Exonic
1157091167 18:44638663-44638685 AGCAGGGGGGTGGGGGGGGGTGG + Intergenic
1157210370 18:45736930-45736952 AGCTTGGGGGTGGGGGTGATGGG + Intronic
1157286227 18:46379135-46379157 ATCAGAGGGTTGGGGGGCCTGGG - Intronic
1157492781 18:48136086-48136108 GGCAGGGGGGCGTGGGTGCTGGG + Intronic
1157748717 18:50159803-50159825 ATCAGTGGCGTGGGGGTGCTGGG - Intronic
1157811124 18:50696811-50696833 GGCAGTGGGGTTGAGGTCCTGGG + Intronic
1158482315 18:57832703-57832725 AGCAAGGGCATGGGAGTCCTTGG - Intergenic
1160079829 18:75714812-75714834 GGCATAGGGGTGGGAGTCCTTGG + Intergenic
1160537182 18:79600861-79600883 AGAAGGGAGGTGGGGGGTCTGGG - Intergenic
1160824789 19:1074539-1074561 AGCTGGTGGCTGGGGGTGCTGGG + Intronic
1160842864 19:1154282-1154304 GGCAGGCGGGGTGGGGTCCTCGG + Exonic
1160847187 19:1171756-1171778 AGCAAGTGGGTGGGGGGTCTAGG + Intronic
1160930829 19:1568705-1568727 TGCAGGGAGGTGGGGGTCCCTGG - Intergenic
1160969677 19:1762066-1762088 AGAGGGCGGATGGGGGTCCTGGG - Intronic
1161061974 19:2219824-2219846 AGCTGTGGGGAGGGGGTACTGGG - Intronic
1161085411 19:2332880-2332902 AGCTGCTGGGTGGGGGCCCTGGG + Intronic
1161236663 19:3201642-3201664 GGCAGGGGGATGGGGGTGCGGGG + Intronic
1161574675 19:5048900-5048922 AGCAGGGGGGTCAGGGACATGGG + Intronic
1161610141 19:5237873-5237895 ATCGGGGGGGTGGGGCGCCTCGG - Intronic
1161687160 19:5708477-5708499 AGCTGGTGGGTGGGGCTCCCAGG - Intronic
1161830720 19:6602228-6602250 AGCAAGGGCATGGGAGTCCTCGG + Intronic
1162097137 19:8316948-8316970 AGCCGTGGGGTGGGGGGCATGGG - Intronic
1162525022 19:11201871-11201893 AGGAGGTGGGTGGGGATCCTGGG - Exonic
1163203769 19:15787524-15787546 AGGAGGGAGGCGGGGGACCTTGG - Intergenic
1163369523 19:16894126-16894148 GGCTGGGGGGTTGGGGTGCTTGG + Intronic
1163454627 19:17399267-17399289 AGGATGGGGGTGGGGGTTGTGGG + Intergenic
1163489616 19:17609540-17609562 AGCGGGGGGCTGAGGGACCTGGG - Intronic
1163513150 19:17747937-17747959 AGCAGGGGGTTGGGGCTACGCGG + Intronic
1163529989 19:17843334-17843356 CCCAGGGGGTTGGGGGTCCAAGG - Intronic
1163847091 19:19643859-19643881 AGGAGGGGGCTGGGGCTCCGTGG - Intergenic
1164633150 19:29774632-29774654 AGAAGGACGGTGGGGGTCCCAGG + Intergenic
1164650167 19:29885724-29885746 AGGAGCTGGGAGGGGGTCCTGGG - Intergenic
1165070935 19:33254473-33254495 GGCAGCGGGGTGGGGGCCGTGGG + Intergenic
1165154040 19:33776925-33776947 AGCAGGGAGGAGGGGGAGCTGGG - Intergenic
1165325391 19:35111656-35111678 GGCAGATGGCTGGGGGTCCTGGG - Intergenic
1165351376 19:35277709-35277731 GGCAGGGGGCTGGGGGTCCGTGG + Intronic
1165446066 19:35857261-35857283 AGCTGGGGGCTGGGACTCCTGGG + Intronic
1166044830 19:40223690-40223712 AGCACGGGCTTGAGGGTCCTGGG + Intronic
1166360963 19:42252893-42252915 AGCTTGGGGGTGCGGGACCTCGG + Intronic
1166695906 19:44851331-44851353 AGCAGGGGGCCTGGGCTCCTGGG - Intronic
1166747373 19:45147702-45147724 AGCAGGGGCCTGGGGGGCCATGG + Intronic
1166810503 19:45511524-45511546 TGCAGGGAGGAGTGGGTCCTGGG + Intronic
1166853135 19:45769748-45769770 GGGTCGGGGGTGGGGGTCCTAGG + Exonic
1167000787 19:46745151-46745173 AGTATGGAGGTGAGGGTCCTGGG - Intronic
1167123171 19:47531234-47531256 GGGGGGGGGGGGGGGGTCCTTGG + Intronic
1167246035 19:48373762-48373784 AGCTCTGGGTTGGGGGTCCTGGG - Intronic
1167249652 19:48393236-48393258 GGCTGGGGGGTGGGACTCCTGGG + Intergenic
1167292991 19:48634874-48634896 AGCAGGGGGTTGGGAATCTTTGG - Intronic
1167298146 19:48663855-48663877 GGCAGGGGCGAGGGGATCCTGGG - Intronic
1167353901 19:48992085-48992107 GGCTGGGGGCTGGGGCTCCTGGG - Intronic
1167730135 19:51248014-51248036 AGCAAGGGCATGGGAGTCCTTGG + Intronic
1167853737 19:52221288-52221310 GGCAAGGGGGTGGGGCTCCCAGG + Intronic
1168102504 19:54148547-54148569 GGCAGCGGGGTGGGGGGCGTGGG + Intronic
1168251948 19:55146631-55146653 AGCTGGGGGGTGGGGGGGCGGGG - Intronic
1168315489 19:55483163-55483185 AGCAGGGGGCTGGGGGCCGGCGG - Exonic
1168392331 19:56020180-56020202 AGCTTGAGGGTGAGGGTCCTAGG - Intronic
1168650128 19:58087280-58087302 AGCAGGTGGGTGAGGGGCCTTGG - Intronic
925997825 2:9306505-9306527 AGCAGGTGGGAAGGGTTCCTAGG + Intronic
926051265 2:9746318-9746340 TGGAGGTGGCTGGGGGTCCTTGG - Intergenic
926107682 2:10162678-10162700 GGCAGGGGGGTGGGGGGCGGCGG - Intronic
926795220 2:16613372-16613394 AGCAGGGGAATGAGTGTCCTTGG - Intronic
927411334 2:22829665-22829687 AACAGGGTGGTGGGGGTGCCAGG - Intergenic
928182973 2:29082704-29082726 GCCAGGTGGGTGGGGGTCCCTGG - Intergenic
929924328 2:46196380-46196402 TGCTGGGGGTTGGGGGTCCTAGG + Intergenic
929924959 2:46200416-46200438 AGCAGAGGGTTGGGTGTCATGGG + Intergenic
930667565 2:54115006-54115028 TGGAGTGGGGTGGGGGACCTGGG + Intronic
932492856 2:72132678-72132700 AGCAGGGAGGGGGCAGTCCTGGG - Intronic
932708581 2:74046417-74046439 TGCTGGGGACTGGGGGTCCTTGG + Exonic
932804871 2:74774804-74774826 TGTCGGGGGGTGGGGGTCCAGGG - Intergenic
932869361 2:75381271-75381293 AGCAAGGGGGTGGGGGGCGAGGG + Intergenic
934050927 2:88210201-88210223 AGCAGGGAGGGAGGAGTCCTTGG + Intergenic
934544806 2:95206046-95206068 AGCAAGGGGCTGTGGGTGCTGGG + Intergenic
935544529 2:104386870-104386892 AGGAGGTGGCTGGTGGTCCTAGG - Intergenic
935652629 2:105395462-105395484 AGCATGGGGGTGGGGGTCATAGG - Intronic
937251636 2:120527683-120527705 GGCAGGAGGCTGGGGGTGCTTGG - Intergenic
937445018 2:121950151-121950173 GGAAGGTGGGTGGGGGTACTGGG + Intergenic
937450727 2:122000310-122000332 AACAGGGGGATGGCGCTCCTGGG + Intergenic
937521742 2:122720711-122720733 AGCTGGGAGGTGGGTGGCCTGGG + Intergenic
937726094 2:125168267-125168289 AGGAGGGCTGTGGGGATCCTGGG + Intergenic
937885870 2:126899709-126899731 TGGAGAGGGGTGGGGCTCCTGGG - Intronic
938073536 2:128320304-128320326 AGCAGGGGCTTTGGGGCCCTAGG - Intergenic
938097975 2:128475630-128475652 AGGAGGGGTGAGGGGGTGCTGGG + Intergenic
938208093 2:129440854-129440876 TGCAGGGGGTTGGGAGGCCTTGG - Intergenic
938480414 2:131657906-131657928 CGCAGGGGGGCGAGGGTCTTCGG + Intergenic
938677989 2:133658098-133658120 AACTAGGGGGTGGGGGTCGTTGG - Intergenic
939043120 2:137216269-137216291 TGCAGGGGGGTGGGGGGCGGGGG - Intronic
940751113 2:157628486-157628508 AGCACGGGGGTGGGGGACAGGGG - Intronic
942177240 2:173345908-173345930 AGCCGGGGTGGGGGGGTACTTGG - Intergenic
943846416 2:192655077-192655099 AGCAAGGGTATGGGAGTCCTCGG + Intergenic
944102011 2:196036943-196036965 AGGAGGGGTGTGTGGGTGCTGGG - Intronic
944660112 2:201914598-201914620 GGAAGTGGGGTGGGGGTCCTGGG + Intergenic
946124548 2:217550920-217550942 AGCAGGGGGCTGGGGCTACAAGG + Intronic
946249982 2:218406007-218406029 AGCGGGGGGGGGGGGGCCCACGG - Intergenic
947720665 2:232367736-232367758 AGCAGGCGGTGGGGGGTCCAGGG - Intergenic
948653959 2:239465296-239465318 AGCCGGGAGGTGGGGGACATGGG + Intergenic
948718887 2:239883658-239883680 CTCAGTGGGGTTGGGGTCCTGGG - Intergenic
948853210 2:240718367-240718389 AGCAGTGGTGAGGGTGTCCTGGG - Intronic
948928234 2:241113802-241113824 AGCAGCGGGGTCGGGGAGCTGGG - Intronic
1169081076 20:2798093-2798115 AGGACTGGGGTGGGAGTCCTGGG - Intronic
1171366539 20:24628722-24628744 AGCAGGGGTGTGTGCTTCCTGGG - Intronic
1172026602 20:31952988-31953010 AGCAGGTGGGTGTGGGTGGTAGG + Intergenic
1172689047 20:36778032-36778054 AGGGAGGGGGTGGGAGTCCTGGG - Exonic
1172699759 20:36845832-36845854 AGCTGGGGGTGGGGGGCCCTGGG + Intronic
1172825320 20:37778129-37778151 TGCAGTGGGGTGGGGGTCAAGGG + Intronic
1173168473 20:40703108-40703130 AGCAAGGGGGTGGGGGTCAAGGG + Intergenic
1173552900 20:43945804-43945826 GGATGGGGGGTGGGGGTGCTGGG + Intronic
1173907451 20:46639213-46639235 GGCAGGGGGGTGGGGGTGAGGGG + Intronic
1174171370 20:48620023-48620045 AGCTGCAGGGTGGGGGTGCTCGG + Intergenic
1174181403 20:48677198-48677220 AGAAGGCAGGTGGGGCTCCTTGG - Intronic
1174425238 20:50427554-50427576 TGAAGGGGGATGAGGGTCCTTGG - Intergenic
1174442884 20:50569976-50569998 AGCAGGGAACTGGGTGTCCTTGG + Intronic
1175119569 20:56707680-56707702 AGCTGGGGGGCGGGGGTCAGGGG + Intergenic
1175771723 20:61628323-61628345 AGCACAGGGGTGGGGGTGCCCGG - Intronic
1175877913 20:62238931-62238953 AGCAGGGGGGCTGGGGATCTCGG - Intronic
1175928602 20:62482713-62482735 TGCAGGGGGTGGGGGGTCCCAGG - Intergenic
1175944893 20:62554093-62554115 AGAAGGGGGCAGGGAGTCCTGGG + Intronic
1175973537 20:62699072-62699094 CCCAGGAGGGTGGGGGTCCCAGG + Intergenic
1176108381 20:63399994-63400016 AGCAGGGGCGGCTGGGTCCTAGG - Intergenic
1176236624 20:64056525-64056547 GGCAGGGGGTGGGGGCTCCTGGG + Intronic
1176445215 21:6815672-6815694 CGCAGGGGGGCGAGGGTCTTCGG + Intergenic
1176515529 21:7780770-7780792 GGCAGGGGAGTGGGTGGCCTGGG - Intergenic
1176804380 21:13465075-13465097 AGCAGCAGGGTTGGGGACCTTGG - Intergenic
1176823382 21:13680705-13680727 CGCAGGGGGGCGAGGGTCTTCGG + Intergenic
1177556995 21:22703693-22703715 AGCAGGAGGGTGGGGTTGGTGGG - Intergenic
1178649557 21:34410782-34410804 GGCAGGGGAGTGGGTGGCCTGGG - Intergenic
1178688107 21:34727551-34727573 AGGCAGGTGGTGGGGGTCCTGGG - Intergenic
1179237294 21:39559291-39559313 AGCAAGGGTATGGGAGTCCTTGG - Intronic
1179675096 21:42975271-42975293 AGCGGGTGGGTCGGGGTCCTGGG + Intronic
1180213645 21:46311550-46311572 GGCAGGAGGCTGGGGGACCTAGG + Exonic
1180481551 22:15760372-15760394 CGCAGGGGGGCGAGGGTCTTCGG + Intergenic
1180953208 22:19730091-19730113 ATCAGTGGGGAGGGGGTCCTGGG - Intergenic
1180961772 22:19765568-19765590 TGCAGGGGGGCGGGGGTCTGAGG - Intronic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1181030190 22:20145807-20145829 AGAAGGACGGTGGGGGCCCTGGG - Intronic
1181808932 22:25391874-25391896 AGCTGCAGGGTTGGGGTCCTGGG - Intronic
1181857542 22:25792831-25792853 GGCAGAGGGGTGGGAATCCTTGG + Intronic
1182665247 22:31953858-31953880 AGCAGAAGAGTAGGGGTCCTGGG + Intronic
1183424697 22:37733233-37733255 AGCAGAGGGGCTGGGGTGCTGGG + Intronic
1183655945 22:39184799-39184821 TGCCGTGGAGTGGGGGTCCTGGG - Intergenic
1183748170 22:39704175-39704197 AGGAGGGAGCTGGGGGTCCTGGG + Intergenic
1183899090 22:40991570-40991592 AGCAGGGAGGTCTGGGCCCTAGG - Intergenic
1184216765 22:43072765-43072787 AGCTGGGTGGTGGGGTGCCTGGG - Intronic
1184233394 22:43170270-43170292 TGCTGGGGGGTCTGGGTCCTAGG + Intronic
1185054683 22:48573295-48573317 AGAAAGGGTGAGGGGGTCCTGGG - Intronic
1185082929 22:48719540-48719562 AGCAGGGTGGTGGTGGGCCGAGG + Intronic
1185276065 22:49950603-49950625 CGCAGGGGGGTGTGGGGCCTGGG + Intergenic
1185303848 22:50101127-50101149 AGCTGGGGGGTGGGAGGTCTGGG + Intronic
949929105 3:9064378-9064400 AGAAGGTGAGTGGGGGCCCTGGG - Exonic
950433672 3:12966433-12966455 AGCAGGGGGGTGGGGCTAAGGGG - Intronic
950476189 3:13216368-13216390 AGCAGGGGACAGGGGGCCCTCGG + Intergenic
950519075 3:13485496-13485518 AGGCTGGGGGTGGGGGGCCTAGG + Intronic
950695412 3:14697697-14697719 AGCAGGGGGGTTGGGGGCTGGGG - Intronic
950902012 3:16506265-16506287 AGCTGGGGTGTGGGGCCCCTGGG + Intronic
951557887 3:23938958-23938980 AGCAGGGGGTTGGAGCTGCTAGG - Intronic
952044331 3:29299783-29299805 AGTATGGGGGTGGGGGTTCCTGG + Intronic
952093586 3:29921492-29921514 GGCAGGGGGGTGGGGGGGCTGGG + Intronic
952989248 3:38817215-38817237 AGCAGGGATGTGGCTGTCCTTGG - Intergenic
953146469 3:40280590-40280612 AACAGGGGGTGGGGTGTCCTTGG + Intergenic
953245298 3:41185465-41185487 ATGAGGAGGGTGGGGGTCCCTGG + Intergenic
953418925 3:42739838-42739860 AGCAGGGCTGTGTGGGACCTTGG + Intronic
954039123 3:47870913-47870935 AGCCGGGGGGTGGTGGAGCTGGG + Exonic
954082311 3:48219833-48219855 AGCACTGGGGAGGGAGTCCTGGG - Intergenic
954146853 3:48638793-48638815 AGCAGGGGTTTGGGGATCCTGGG - Intronic
954427378 3:50450499-50450521 AGCAGGGTGATGGGGGTGCAGGG - Intronic
954783339 3:53075866-53075888 AGCAGGGTGCTGGTGGCCCTGGG + Intronic
956802116 3:72769132-72769154 AGCAGGCAGGTGGGGGTCTGTGG + Intronic
959280034 3:104325657-104325679 AGCAAGGGCATGGGAGTCCTTGG + Intergenic
961280665 3:125764023-125764045 AGCGGGGGGGTGGGGGGGTTAGG + Intergenic
961313079 3:126016207-126016229 AGCTGGAGGGTGGTGGACCTGGG + Intronic
961520761 3:127466283-127466305 AGGAGTGGGGTGGGGCTCCTGGG - Intergenic
961667514 3:128502910-128502932 AGCACAGGGGTGGGGGCCCGTGG + Intergenic
961883772 3:130082040-130082062 AGCAGGGGGGTGGTGCTGGTTGG + Intronic
962040936 3:131706882-131706904 AGAAGTGGGGTGGGGGGCATTGG - Intronic
962207718 3:133448648-133448670 AGGAGGGGGCTGGGGTTGCTGGG + Intronic
962355779 3:134693179-134693201 AGCTGTTGGGTGGGGCTCCTAGG + Intronic
962856909 3:139355249-139355271 AGCAGGAGGGTGGTGGTCACAGG - Intronic
963004855 3:140717356-140717378 AGCAGGGAGGTGGGGGGAATGGG + Intergenic
967082552 3:186063755-186063777 AGCAGGGGGTAGGGAGTACTGGG - Intronic
967269620 3:187722313-187722335 AGCTGGGGGTTGGGGGTGGTGGG - Exonic
968076384 3:195817853-195817875 AGCAGGGAGGTGGGTGGGCTGGG + Intergenic
968431108 4:559683-559705 AGCAAGGGCATGGGAGTCCTTGG - Intergenic
968450702 4:674742-674764 GGCAGGGACCTGGGGGTCCTGGG + Intronic
968540431 4:1165538-1165560 AGCATGGAGCTGGGGGTCCCTGG - Intergenic
968641567 4:1717502-1717524 AGCAGCCAGGTGGGGGGCCTGGG - Exonic
968658731 4:1789923-1789945 AGGAGGTGGGTGGGGGTGCAGGG + Intergenic
968660246 4:1795792-1795814 AGCAGGGGTCTGGGGGTGCAGGG + Intronic
968725889 4:2247651-2247673 GGCAGTGGGGAGGGGGTCCCAGG + Exonic
968863078 4:3188145-3188167 GGCAGTGGGGTGGCTGTCCTGGG + Intronic
968941879 4:3643241-3643263 AGCAAGGATGTGGGGGTCCTGGG + Intergenic
968952974 4:3704079-3704101 AGCAGGTGGGTGGGGAGCCGTGG + Intergenic
968955674 4:3717586-3717608 TGCAGGGCGGTGGGGGCTCTGGG + Intergenic
969358630 4:6647138-6647160 AGCAGGGTGGAGGAGCTCCTTGG + Intergenic
969466717 4:7361675-7361697 AGAAGGGGTGTGGGGGCCCGGGG + Intronic
969597395 4:8157183-8157205 AGAAGGGGTGTGGGGGCACTGGG - Intronic
970029929 4:11662942-11662964 AGGCGGGGGGTGGGGGTGGTGGG + Intergenic
971216073 4:24663204-24663226 AGCTGGGGTGTGGGGGACCTTGG + Intergenic
972149942 4:36076992-36077014 AGCAAGGGCATGGGAGTCCTTGG + Intronic
972430347 4:38975728-38975750 ATCAGGGGGGTGGGACTCCTGGG - Intronic
972960477 4:44447517-44447539 AGCAGGGGGCGAGGGGTGCTGGG + Intronic
978605060 4:110470928-110470950 AGCAGGGGGTTGGGGGGCAGGGG + Intronic
978885359 4:113761480-113761502 AGCAGAGGGGAGGGAGTCCGAGG + Intronic
979455595 4:120922738-120922760 GGCAGGGAGGTGGGGATTCTGGG - Exonic
983553543 4:169039896-169039918 AGTGGGGAGGTTGGGGTCCTCGG + Intergenic
984146769 4:176071064-176071086 AGAAGGGGAGCGAGGGTCCTGGG + Intronic
985240852 4:187929648-187929670 AGCTGGGAGGTGGGGAGCCTGGG - Intergenic
985564586 5:608978-609000 AGGAGGGGGGTGGTTCTCCTGGG - Intergenic
985574315 5:666456-666478 CGCCGGGAGCTGGGGGTCCTAGG + Intronic
985611564 5:892460-892482 GGCACGCGGGAGGGGGTCCTGGG - Intronic
985664589 5:1175435-1175457 AGGCTGGGAGTGGGGGTCCTGGG + Intergenic
985732390 5:1556544-1556566 AGCAGTGGGGTGCGGGTCACTGG + Intergenic
985836338 5:2274837-2274859 AGCAGGGAGGAGGGGGTCAGTGG + Intergenic
986021539 5:3808993-3809015 ATCAGAGGGGTGGGGGCACTGGG + Intergenic
986817230 5:11426068-11426090 AGGAGGAGGGTGGGGGTCAATGG - Intronic
987990203 5:25200065-25200087 AGCAGGGGGGTGGCATTCGTCGG + Intergenic
989472639 5:41838198-41838220 AACAGGGGGCTGGAGGTCCAGGG + Intronic
992314399 5:75537269-75537291 AGCATGGGGGTGGGGGGCACAGG + Intronic
992416434 5:76556481-76556503 AGCAAGGGTATGGGAGTCCTTGG - Intronic
994077238 5:95667313-95667335 AGTGGGGGGGTGGGGGTGCTGGG + Intronic
994118589 5:96088876-96088898 AGCAGGCTGGTGGGGTTGCTGGG + Intergenic
994458223 5:100041777-100041799 AGCAGGGAGTTGAGGGTCTTAGG + Intergenic
995067374 5:107877398-107877420 AGACGGCGGGTGGGGGTCGTGGG + Intronic
995267904 5:110186274-110186296 TGTAGGGGGGTGGGGGGCATGGG - Intergenic
995548652 5:113257701-113257723 TGCATGGGGGTGTGGGTGCTGGG + Intronic
997642010 5:135455504-135455526 AGCAGAGAGGTGGGGGATCTGGG + Intergenic
998019750 5:138759491-138759513 AGTAGGGAGGTGGGGGCCCTTGG + Intronic
998134032 5:139665396-139665418 AGCAAGGAGGTGGGGGCTCTGGG - Intronic
998451143 5:142235587-142235609 AGCAGGAGGAGGGGGGGCCTGGG - Intergenic
1000148105 5:158472800-158472822 GGCAGGGGGGTGGGGGGGCGAGG - Intergenic
1000386087 5:160675862-160675884 AGCAGGGGGGTGGGGGAGGGGGG + Intronic
1000725580 5:164766032-164766054 AGCGGGGGCGGGGGGGTCTTTGG - Intergenic
1000878804 5:166672300-166672322 AGCAGGGGGGTGAGGATCAGGGG + Intergenic
1002020428 5:176361148-176361170 AGCTGGGGGGTGGGGGCACAGGG - Intronic
1002044127 5:176532479-176532501 GGCAGGGGGGTGGAGGGGCTGGG + Exonic
1002079214 5:176727668-176727690 TGCAGGGGCGTGGGGGACCCCGG + Intergenic
1002085829 5:176774803-176774825 AGCAGGTGATTGGGGGCCCTTGG - Intergenic
1002449036 5:179308752-179308774 TGCAGGAGGGTGGGGTTCCATGG - Intronic
1002451854 5:179323318-179323340 AGCTGGAGGGTGGGGGGCCCAGG - Intronic
1004485232 6:16060230-16060252 GCCAGGTGGGAGGGGGTCCTTGG + Intergenic
1005048692 6:21665211-21665233 AGCAGGGAGGTGGGGGAAATGGG - Intergenic
1005990123 6:30897302-30897324 GGCAGGGGGGTGGGGGCGCGGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006340409 6:33443521-33443543 AGCAGGGGGCTTGGGGACCCCGG - Exonic
1006429240 6:33984960-33984982 AGTCTGGAGGTGGGGGTCCTGGG - Intergenic
1006430445 6:33992724-33992746 AGCAGGAGGGTGAGGGTCTGGGG - Intergenic
1006633098 6:35443368-35443390 TCCAGGGGGCTGGGGGTCTTTGG - Intergenic
1006668298 6:35713611-35713633 AGCTGGCGGGTGGGGGCCCAAGG + Intronic
1006898832 6:37486999-37487021 GGCAGGGGGGTGGGGGTTGGGGG + Intronic
1006922234 6:37634592-37634614 AGCAGGTGGGTGGGGGATGTGGG - Exonic
1006981947 6:38154261-38154283 AGGAGGGGGCGGGGGGCCCTGGG - Exonic
1007073432 6:39052358-39052380 AGGAAGGAGGTTGGGGTCCTGGG + Intronic
1007111087 6:39313890-39313912 ACCAGAGGGTTGGGGGACCTCGG - Intronic
1007301587 6:40871862-40871884 AGCAGTGGGGAGGGGGACCAAGG - Intergenic
1007419612 6:41711798-41711820 GGCAGGGGGGTGGGGGAACATGG + Intronic
1007449260 6:41930776-41930798 AGCTGGGGGTTCGGGGGCCTTGG + Intronic
1007702926 6:43774950-43774972 GGCAGGGGGGCGGGGCGCCTGGG - Intronic
1007742560 6:44021762-44021784 AGGAGGGGTGTGGTGGTGCTGGG - Intergenic
1007743131 6:44024981-44025003 AGGAGGGGTGTGGTGGTGCTGGG - Intergenic
1007816564 6:44529252-44529274 AGCAGGAGGGTGGGGGTGGAGGG + Intergenic
1008806942 6:55441141-55441163 AGGAGTGGGGTGGGGGTCAGTGG + Intronic
1009215468 6:60914752-60914774 AGCAAGGGCATGGGAGTCCTCGG - Intergenic
1009907796 6:69890833-69890855 GCCAGGTGGGAGGGGGTCCTTGG - Intronic
1010826028 6:80476436-80476458 AGAAGGCGGGTGGGGATTCTAGG + Intergenic
1011684194 6:89811284-89811306 AGCGGGTGGGTGGGGGTTATAGG + Intronic
1012825813 6:104145424-104145446 AGTAGGGGTATGGGAGTCCTTGG + Intergenic
1013619115 6:111872340-111872362 AGCAGAGGGGTGGGGGACAGAGG + Intronic
1014778985 6:125541790-125541812 AGCAGGGAGGAGGGGCTGCTTGG - Intergenic
1016461805 6:144286056-144286078 AGCTCGGGCGTGGAGGTCCTTGG + Intronic
1016916249 6:149247093-149247115 AGGAGAGGGGTGGGGGTTGTCGG - Intronic
1017215425 6:151901131-151901153 GGCAGGGGGGTGAGGTTCCCAGG + Intronic
1017898812 6:158703376-158703398 GGCAGGGTGGTGGGGGCCCTTGG + Intronic
1018359695 6:163054877-163054899 GCCAGGGGGGAGGCGGTCCTTGG - Intronic
1019020389 6:168913067-168913089 AACAGGAGGGTGGGGGTGCAAGG - Intergenic
1019029008 6:168994549-168994571 AGCAGGGGAGTGGGGGGCGCAGG + Intergenic
1019356847 7:584739-584761 AGGAGGGAGGTGGGGGGCATAGG - Intronic
1019427312 7:983701-983723 AGCAGAGGGGAGGAGGGCCTGGG + Intronic
1019473660 7:1233829-1233851 AGTGGAGGGGTGGGGGTTCTGGG + Intronic
1019499762 7:1359005-1359027 CCCAGAGGGGTGGGGGTCCCTGG + Intergenic
1019716784 7:2542828-2542850 ACCATGCGGGTGGGGGGCCTGGG - Intronic
1019985905 7:4655484-4655506 TGCAGGGGGGTGGGGGTGTGGGG + Intergenic
1020137731 7:5596026-5596048 GGCGCGGGGGTGGGGGTACTTGG + Intronic
1020344572 7:7149159-7149181 AGGAGAGGGGGTGGGGTCCTGGG - Intergenic
1020445237 7:8261695-8261717 ACCAGGGAGCTCGGGGTCCTGGG + Intronic
1021924787 7:25523841-25523863 AGCAGTGGCGTGGGGGTAATGGG + Intergenic
1022442515 7:30445939-30445961 GGCAGGGGGGAGGGGGACCGGGG + Intronic
1022515005 7:30969797-30969819 AGGAGGGGGCTGGGGGTGCCAGG - Intronic
1024917936 7:54524857-54524879 AGCTGGGAGGTGGGTGGCCTTGG - Intergenic
1024969326 7:55054138-55054160 AGAAGGCGGGTGGGGAGCCTGGG - Intronic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1029128509 7:98312367-98312389 ACCAGGAGTGTGGGGGCCCTGGG + Intronic
1030098523 7:105923317-105923339 ATCAGGGGGGTGGGGGTGATGGG + Intronic
1030311372 7:108072620-108072642 AGCATGGGGTTAGAGGTCCTGGG - Intronic
1031626318 7:123996669-123996691 AGCAAGTGTATGGGGGTCCTCGG - Intergenic
1032012032 7:128352922-128352944 AGCAGGGAGCTGGGGGGCCGAGG - Intronic
1032240290 7:130154401-130154423 AGCAGGGGGGTGGCGGGCAGGGG + Intergenic
1032481898 7:132253952-132253974 ATCACTGGGCTGGGGGTCCTAGG + Intronic
1032504442 7:132424923-132424945 AGCAGAGGGGTGGCCTTCCTGGG - Intronic
1033290065 7:140076080-140076102 AGGCCGGGGGTGGGGGTCCATGG - Intergenic
1035414440 7:158671082-158671104 GGCAGGGGGGTGGGGGTGGGGGG + Intronic
1035414463 7:158671164-158671186 GGCAGGGGGGTGGGGGTGGGGGG + Intronic
1037611955 8:20483307-20483329 GGCAGGGAGGCAGGGGTCCTGGG + Intergenic
1037881370 8:22575023-22575045 AGGATGGGGGTGGGGGACTTGGG - Exonic
1038652782 8:29420822-29420844 AGCAGGGGCCTGGAGGTGCTGGG + Intergenic
1039859747 8:41447176-41447198 GGGATGGGGGTGGGGGACCTAGG - Intergenic
1040102686 8:43519416-43519438 GGGAGGGGGGTGGGGGTGCAAGG + Intergenic
1041214969 8:55591328-55591350 AGCAGGGGGAGGATGGTCCTGGG + Intergenic
1041648741 8:60280933-60280955 AGAGGGGGCGTGGGGGTGCTCGG + Intronic
1043435833 8:80235830-80235852 ATCAGGGAGGTGGGGGTGCCTGG - Intergenic
1044628347 8:94256196-94256218 AGCAGGTGGGAGGGGGTCAGAGG - Intronic
1044628364 8:94256281-94256303 AGCAGGTGGGAGGGGGTCAGAGG - Intronic
1047949424 8:129918097-129918119 AACAGGGTGGTGGTGGTCCATGG - Intronic
1048507737 8:135035817-135035839 GGAAGGAGGGTGGGGGCCCTTGG + Intergenic
1048941360 8:139403370-139403392 AGCAGGGGAGTGGGAACCCTTGG - Intergenic
1049025326 8:139984442-139984464 AGCCTGGGGGTGGGGGGCCGGGG + Intronic
1049089068 8:140500535-140500557 ACCAGGTGGGTCTGGGTCCTTGG + Intergenic
1049308457 8:141920513-141920535 TGGAGGGTGGTGGGAGTCCTGGG - Intergenic
1049309162 8:141924283-141924305 AGCATGGAGGTGGGGGCCCTCGG - Intergenic
1049405962 8:142451971-142451993 AGGAGGGGGCGGGGGTTCCTGGG + Intronic
1049574694 8:143384713-143384735 GGGAGGGGGGCGGAGGTCCTGGG + Intergenic
1049762282 8:144336918-144336940 GGGCGGGGGGCGGGGGTCCTGGG + Intergenic
1050278863 9:4029593-4029615 AGAAGGGTGGTGGGGGGCTTGGG - Intronic
1050287450 9:4118091-4118113 GGTAAGGGGGTGGGGGGCCTGGG + Exonic
1051750078 9:20332054-20332076 AGCAGGGTGGTGTGGGTGGTGGG - Intergenic
1051819561 9:21149255-21149277 TGCTGGGGTGTGGGGGTACTGGG + Intergenic
1052855615 9:33404476-33404498 AGCAGGGGGATGGGGCACCGGGG + Intergenic
1053020684 9:34691820-34691842 AGATGTGGGATGGGGGTCCTGGG - Intergenic
1053072063 9:35107560-35107582 GGCAGGGGCCTGGGGGTCCAGGG + Exonic
1053073942 9:35116734-35116756 TGCAGGCGGGTGTGGGTTCTGGG + Intergenic
1053166263 9:35846188-35846210 AGCAGGTGGGTGAGGGTTCTTGG + Intronic
1053595018 9:39551802-39551824 AAGAGGGGGGAGGGGGTGCTAGG - Intergenic
1053852800 9:42306830-42306852 AAGAGGGGGGAGGGGGTGCTAGG - Intergenic
1054154069 9:61627973-61627995 AACAGTGGGGTGGGGGTCGGAGG - Intergenic
1057195061 9:93112124-93112146 CGCAGGGGAGTGGGGGTGCCAGG - Intronic
1057196228 9:93116748-93116770 TGCAGGGGGGTGAGGGACCAGGG + Intergenic
1057269370 9:93640371-93640393 AGCATGTGGGTGGGGGTCAAGGG - Intronic
1057676520 9:97140393-97140415 AGTAGTGGGGTGGGGGTGTTGGG - Intergenic
1057832716 9:98419253-98419275 TGCTGGGAGGTGGGGCTCCTGGG + Intronic
1058144816 9:101399263-101399285 AGGAGGTTGGTGGGGGGCCTGGG - Intronic
1058513966 9:105751238-105751260 AGCAGTGGGGTGGGGGACCATGG + Intronic
1058814167 9:108668437-108668459 AGGATGGGGGTGGGGGTCGAGGG - Intergenic
1059039811 9:110800451-110800473 AGGAGAGGGGTGGGGGCCCAGGG - Exonic
1059450484 9:114368446-114368468 CGCAGAGGCCTGGGGGTCCTCGG + Exonic
1060301475 9:122376902-122376924 AGCAAGGGGGTGGTGGTCTGAGG + Intronic
1060491679 9:124089750-124089772 AGTAGGTGGGAGGGGGTGCTGGG + Intergenic
1060996100 9:127875598-127875620 TGCACAGGGATGGGGGTCCTTGG - Intronic
1061004583 9:127921324-127921346 AGCAGGGGGCCGGGAGGCCTGGG + Exonic
1061043657 9:128153173-128153195 TGCAGTGGGCTGGGGGTCTTGGG + Intronic
1061050433 9:128191699-128191721 AGCAGGTGCGAGGGGGTCCTGGG + Intronic
1061226369 9:129283274-129283296 AGCAGGGGTCTGGGAGCCCTTGG - Intergenic
1061276221 9:129570587-129570609 AGCTGGGGGGTGGGGGACTGGGG - Intergenic
1061386033 9:130289858-130289880 AGGATGGGGCTGTGGGTCCTGGG - Intronic
1061401438 9:130370507-130370529 CCCAGGGGGGTGGGGGTGTTGGG - Intronic
1061429813 9:130523885-130523907 GGGAGGAGCGTGGGGGTCCTTGG - Intergenic
1061582467 9:131546178-131546200 AGCAGGGGAGTGGGCGACCCTGG + Intergenic
1061598296 9:131647034-131647056 AGCAGTGAGCAGGGGGTCCTGGG - Intronic
1061666218 9:132162176-132162198 CGCCGGAGGGTGGCGGTCCTCGG + Exonic
1061817102 9:133204044-133204066 AGCAGTGGGGAGGGTCTCCTTGG - Intergenic
1062037698 9:134390056-134390078 AGGATGGGGGTGGCCGTCCTGGG + Intronic
1062043224 9:134413708-134413730 AGCAGGAGGGAGGGGGTCTGGGG - Intronic
1062070815 9:134554093-134554115 AGCAGGGGGGTGTGGGGGCTGGG + Intergenic
1062105410 9:134752416-134752438 AGTCGGGGGGGGGGGGCCCTTGG + Intronic
1062137832 9:134939017-134939039 AGCAGAGGGGTGGGGGTGGCTGG - Intergenic
1062255505 9:135618984-135619006 AGCAGAGGGGTGAGGGGCCCAGG - Intergenic
1062337394 9:136078227-136078249 TTGCGGGGGGTGGGGGTCCTGGG - Intronic
1062349940 9:136133559-136133581 AGGCGGGGGGTGGGGGACCCAGG + Intergenic
1062361990 9:136192725-136192747 TGCAAGGGGGATGGGGTCCTGGG + Intergenic
1062395512 9:136351109-136351131 TGCAGAGGGGTGTGGGTGCTGGG + Intronic
1062395987 9:136353052-136353074 GGCAGGGCGGTGGTGGCCCTGGG + Intronic
1062401296 9:136373818-136373840 GGCCGGGGGCTGGGGGTCCTGGG + Intergenic
1062425448 9:136504063-136504085 AGGAGGCAGGTGGAGGTCCTGGG - Intronic
1062431371 9:136528224-136528246 AGCAGAGGGGTGGGGGTGTGGGG + Intronic
1062534206 9:137014459-137014481 AGACCGGGGATGGGGGTCCTGGG - Intronic
1203523980 Un_GL000213v1:68853-68875 CGCAGGGGGGCGAGGGTCTTCGG - Intergenic
1185568118 X:1112107-1112129 CGGTGGGGGGGGGGGGTCCTTGG + Intergenic
1185683237 X:1906217-1906239 AGCAGAGGGGTGAGGGAGCTGGG + Intergenic
1185775801 X:2802081-2802103 AGCAAGGGTATGGGAGTCCTTGG - Intronic
1189233657 X:39471479-39471501 AGGAGGGGCGTTGTGGTCCTTGG - Intergenic
1189333904 X:40158445-40158467 CGCAGCGGGGAGGGGGGCCTCGG - Intronic
1189448584 X:41105260-41105282 AGCATGGGGTTGGGGGTTATAGG - Intronic
1190010896 X:46783765-46783787 AGCATGGGGGTGGGGCTGATGGG + Intergenic
1190245658 X:48688796-48688818 GGCCTGGGGGTGGGGGTCCCCGG - Exonic
1190303121 X:49067727-49067749 GGCACGGGTGTGGGGGTCCTTGG - Exonic
1192165169 X:68823509-68823531 AGCTGGAGGGTGGTGGGCCTGGG + Intergenic
1194522450 X:94935748-94935770 AGCAGGGGTATGGGGGTCGGGGG - Intergenic
1196314914 X:114211108-114211130 AGGAGGGGGGCAGGGGCCCTCGG + Intergenic
1196800378 X:119537903-119537925 AAAAGAGGGGTGGGGGTCCCAGG - Intergenic
1196948628 X:120853482-120853504 AGCATGGGGGTGGAGGTCAAGGG + Intergenic
1197727837 X:129788114-129788136 GGCAGGGGGGTGGGGGTGGGAGG + Intronic
1199540487 X:148952988-148953010 AGCTGGGGGGCCAGGGTCCTAGG + Intronic
1199698078 X:150357925-150357947 AGCCTGGGGGTGGGGGTCTCTGG + Intergenic
1200092535 X:153642633-153642655 GGGTGGGGGGTGGGGGTCCCCGG - Intronic
1200948110 Y:8865941-8865963 TGGAGGGGGGTGGGGGTGCCGGG + Intergenic