ID: 1140410536

View in Genome Browser
Species Human (GRCh38)
Location 16:74738165-74738187
Sequence CCGTCTCAGCCCAGAGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 191}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140410527_1140410536 0 Left 1140410527 16:74738142-74738164 CCCAGGGCCCAGCCCTCGCCCTT 0: 1
1: 0
2: 4
3: 37
4: 426
Right 1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG 0: 1
1: 0
2: 0
3: 22
4: 191
1140410525_1140410536 9 Left 1140410525 16:74738133-74738155 CCACATCCTCCCAGGGCCCAGCC 0: 1
1: 3
2: 8
3: 142
4: 1495
Right 1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG 0: 1
1: 0
2: 0
3: 22
4: 191
1140410524_1140410536 12 Left 1140410524 16:74738130-74738152 CCTCCACATCCTCCCAGGGCCCA 0: 1
1: 0
2: 7
3: 96
4: 789
Right 1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG 0: 1
1: 0
2: 0
3: 22
4: 191
1140410521_1140410536 22 Left 1140410521 16:74738120-74738142 CCAGAGTAGGCCTCCACATCCTC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG 0: 1
1: 0
2: 0
3: 22
4: 191
1140410526_1140410536 3 Left 1140410526 16:74738139-74738161 CCTCCCAGGGCCCAGCCCTCGCC 0: 1
1: 0
2: 10
3: 114
4: 883
Right 1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG 0: 1
1: 0
2: 0
3: 22
4: 191
1140410530_1140410536 -8 Left 1140410530 16:74738150-74738172 CCAGCCCTCGCCCTTCCGTCTCA 0: 1
1: 0
2: 0
3: 17
4: 281
Right 1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG 0: 1
1: 0
2: 0
3: 22
4: 191
1140410528_1140410536 -1 Left 1140410528 16:74738143-74738165 CCAGGGCCCAGCCCTCGCCCTTC 0: 1
1: 0
2: 19
3: 85
4: 717
Right 1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG 0: 1
1: 0
2: 0
3: 22
4: 191
1140410520_1140410536 26 Left 1140410520 16:74738116-74738138 CCGTCCAGAGTAGGCCTCCACAT 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG 0: 1
1: 0
2: 0
3: 22
4: 191
1140410529_1140410536 -7 Left 1140410529 16:74738149-74738171 CCCAGCCCTCGCCCTTCCGTCTC 0: 1
1: 0
2: 0
3: 30
4: 350
Right 1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG 0: 1
1: 0
2: 0
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140410536 Original CRISPR CCGTCTCAGCCCAGAGACAC AGG Intronic
900000877 1:14262-14284 CCCTCTCATCCCAGAGAAACAGG + Intergenic
900020591 1:184778-184800 CCCTCTCATCCCAGAGAAACAGG + Intergenic
900793521 1:4694154-4694176 CCAGCTCAGCCCAGGGGCACGGG + Intronic
900990670 1:6096844-6096866 CCCTCTCTCCCCGGAGACACTGG - Intronic
905972699 1:42153667-42153689 CCATCACAGCCCAGAGACCAAGG + Intronic
908137304 1:61146380-61146402 GCAGCTCAGCCCAGGGACACTGG - Intronic
910806910 1:91197586-91197608 CAGTCACACCCCAGAGAGACTGG + Intergenic
912879124 1:113390950-113390972 CCGTCTCAGCCCGGGGGCCCTGG - Exonic
913319672 1:117579406-117579428 CCTTCTCTGCCCAGAGCCCCAGG + Intergenic
914048202 1:144107813-144107835 CCGCCTGAGCACAGAGCCACAGG + Intergenic
914130982 1:144857635-144857657 CCGCCTGAGCACAGAGCCACAGG - Intergenic
916122637 1:161542463-161542485 CCATCTGAGCCCAGAGATAAGGG - Exonic
916132535 1:161623900-161623922 CCATCTGAGCCCAGAGATAAGGG - Intronic
916650990 1:166834242-166834264 AGGTCCCAGCCCAGGGACACAGG + Intergenic
916919602 1:169450098-169450120 AAGTCACAGCCCAGGGACACAGG - Intronic
918555103 1:185789880-185789902 CAGTTTCAGCCCAGAGATAGGGG - Intronic
919829632 1:201531442-201531464 CCGTGGCAGCCCAGAGTCTCCGG + Intergenic
922084592 1:222333920-222333942 ACGTCTAAGCCCAGAGACCTTGG - Intergenic
924196697 1:241615095-241615117 CCCACTCAGCCCATAGACTCTGG - Intronic
1063450310 10:6145930-6145952 CCCTCTCAGCTCAAAGACCCGGG + Intronic
1064030579 10:11880348-11880370 CCGGCCCAGTCCAGGGACACTGG + Intergenic
1064919567 10:20502000-20502022 CCTTCCCAGCCCAGCAACACAGG + Intergenic
1068218101 10:54009820-54009842 CCGTGTCAGCCTGGAGGCACCGG - Intronic
1073290980 10:102413176-102413198 ACCTGTCAGCCCAGAGACAGAGG + Intronic
1074612766 10:115037780-115037802 TCGTCTCAGCCCAGAAGTACAGG - Intergenic
1074715565 10:116215544-116215566 CCTTCTCAGCCCCGTGACAGGGG - Intronic
1074805372 10:117045356-117045378 AGGTCACAGCCCAGAGGCACAGG + Intronic
1075898226 10:126016790-126016812 CCATCTCAGGCCAGAGCCAAGGG - Exonic
1076453605 10:130574179-130574201 CTGTCTCAGGGCAGACACACAGG + Intergenic
1077252349 11:1566232-1566254 CCATCTCATCCCTGGGACACAGG + Intronic
1078434778 11:11315484-11315506 CCACCCCAGCCCAGAGACTCTGG + Intronic
1082733170 11:56824910-56824932 CCATCACAGCCCAGAGACTAAGG - Intergenic
1083390039 11:62342098-62342120 CCGTTTCAGCCAATAGAAACCGG - Intronic
1083830113 11:65226026-65226048 CCACCTCACCCCAGACACACTGG - Intergenic
1084105130 11:66975983-66976005 CCCTCTCACCCCAGAGAAAAAGG + Intronic
1087459241 11:98424258-98424280 TCATCTCAGCCCAGAAATACAGG + Intergenic
1089674394 11:120080259-120080281 CCTTCTCAGCCCAGTGACAATGG + Intergenic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1090833402 11:130436169-130436191 CTGCCTCAGCCTACAGACACTGG + Intergenic
1091332658 11:134742543-134742565 CAGTCTCATCTCAGAGGCACTGG + Intergenic
1091414322 12:268024-268046 ATGTCTCAGCCCAGAGAGAGAGG + Intergenic
1091590865 12:1842355-1842377 CCATGTCAGCCTAGAGAGACAGG + Intronic
1092204240 12:6606163-6606185 CCGGCTCTGCACAGAGACAGCGG + Intronic
1092229012 12:6766650-6766672 CCGTCTCGGCCCCGGGACCCCGG + Exonic
1093186305 12:16023088-16023110 CAGTTACAGCCCAGGGACACAGG + Intronic
1093896348 12:24578802-24578824 AGGTCTCAGCCCCAAGACACAGG + Intergenic
1094089098 12:26628491-26628513 CAGTCTCCTCCCAGAGACAATGG - Intronic
1095096792 12:38153397-38153419 CCGTCCCAGGCCAGGCACACGGG - Intergenic
1096879810 12:54658472-54658494 CCGTGTCAGCCCAAGGGCACTGG - Intergenic
1099907121 12:88784662-88784684 AGTTCGCAGCCCAGAGACACAGG + Intergenic
1103942122 12:124506839-124506861 CCGTCACAGCCCAGGGGCACGGG - Intronic
1106135575 13:26970874-26970896 CCGACTCACCCAATAGACACTGG - Intergenic
1106433026 13:29699732-29699754 GGGTCTCAGCCCAGAGATGCAGG + Intergenic
1110790808 13:79584714-79584736 AGGTCACAGCCCAGGGACACAGG + Intergenic
1114649548 14:24275616-24275638 CCGTCACAGACCAGAGAGTCTGG + Intergenic
1119724426 14:76913623-76913645 CCCTCTGAGCCCAGAGTCCCAGG - Intergenic
1119899920 14:78250824-78250846 CCATCTCACGACAGAGACACAGG - Intronic
1122383697 14:101329433-101329455 AAGTCTCAGCTCAGAGTCACGGG + Intergenic
1122900319 14:104779691-104779713 GGGACTCAGCCCAGAGACCCCGG + Intronic
1129663246 15:77565042-77565064 CGGCCTCAGCCCAGAGCCTCTGG + Intergenic
1132452633 15:101976683-101976705 CCCTCTCATCCCAGAGAAACAGG - Intergenic
1132454266 16:13943-13965 CCCTCTCATCCCAGAGAAACAGG + Intergenic
1137308910 16:47233744-47233766 AGGTCACAGCCCAGGGACACAGG + Intronic
1139705635 16:68738426-68738448 CCTACTCCGCCCAGGGACACCGG - Intronic
1140410536 16:74738165-74738187 CCGTCTCAGCCCAGAGACACAGG + Intronic
1141395079 16:83697409-83697431 CCTTCTGTGCCCAGAGACGCTGG - Intronic
1144772264 17:17766483-17766505 TCTTCTCAGGCCAGAGACCCAGG + Intronic
1145888038 17:28396359-28396381 TTGTCTCAGCCCAGGGAGACTGG - Exonic
1150449030 17:65250404-65250426 TGTCCTCAGCCCAGAGACACTGG - Intergenic
1152148268 17:78582434-78582456 ATGTCTCAGCCCAGACACAAAGG - Intergenic
1152244477 17:79177936-79177958 CCGTCTCTGTCCAGAGACTGGGG - Intronic
1152745195 17:82035631-82035653 CCGTCTCACCCCAGAGGTTCTGG + Intronic
1153997634 18:10455185-10455207 CCGTCTCAGCCCTGGGAGAGGGG + Intronic
1159865738 18:73702743-73702765 CTGTAACAGCCCAGAGACACTGG - Intergenic
1161335906 19:3713142-3713164 CCGGCTCAGCCCTAAGGCACTGG - Intronic
1162803188 19:13122351-13122373 CTGTCTCAGCCATGAGACTCTGG + Intronic
1163580816 19:18137546-18137568 CCTCCTGAGCCCAGACACACAGG - Intronic
1166944056 19:46386345-46386367 CCCTGTGAGCCCAGGGACACGGG - Intronic
1168013774 19:53555142-53555164 CCATCTCAGCACAGAGACGCTGG - Intronic
1168013796 19:53555294-53555316 CCATCTCAGCACAGAGACGCTGG - Intronic
1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG + Intronic
1202687654 1_KI270712v1_random:60708-60730 CCGCCTGAGCACAGAGCCACAGG + Intergenic
925512326 2:4641679-4641701 CCGTCTTTGCTCAGAAACACTGG + Intergenic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
929593901 2:43163824-43163846 CCATCTCAGCAAAGAGACAAGGG + Intergenic
929780286 2:44952796-44952818 CCGCTTCAGCTCAGACACACAGG - Intergenic
931861768 2:66362249-66362271 ACTTCTCAGGCCATAGACACTGG + Intergenic
934076820 2:88435564-88435586 AGGTCACAGCCCAGAGGCACAGG - Intergenic
934847221 2:97669609-97669631 CCGTCACTGTCCACAGACACAGG + Intergenic
936455940 2:112674408-112674430 CCGTCTCAGCAGAGCGAAACAGG + Intergenic
936568846 2:113599157-113599179 CCCTCTCATCCCAGAGAAACAGG - Intergenic
936972391 2:118187849-118187871 CCCTCTCAGCCCAGGTACATGGG - Intergenic
937721942 2:125109320-125109342 AAGTCACAGCCCAGAGACAGAGG - Intergenic
938806441 2:134810681-134810703 TCGTCTCAGCCCAGAAGTACAGG + Intergenic
938906617 2:135842786-135842808 CCATTTCACCCCAGTGACACTGG - Intronic
938978991 2:136507788-136507810 CCATCTCAGCTCAGAGACTTTGG + Intergenic
940120687 2:150261337-150261359 AAGTCAGAGCCCAGAGACACAGG + Intergenic
942108411 2:172656401-172656423 AGGTCACAGCCCAGGGACACGGG - Intergenic
942470903 2:176258616-176258638 TCTTCTCAGCCCAGAAAGACAGG - Intergenic
944476335 2:200110483-200110505 CAGTCCCAGCCCAGAGACAAGGG - Intergenic
1168836601 20:881779-881801 CTTTCTCAGCCCAGAGAATCTGG - Intronic
1169182533 20:3582240-3582262 CCGTCTGAGCCCAGTGATGCTGG + Exonic
1171371688 20:24666307-24666329 CTGCCTCAGCCTAAAGACACAGG + Exonic
1171976193 20:31596182-31596204 CAGTCCCAGCCCAGAGGCGCCGG + Intergenic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1173039832 20:39451936-39451958 CAGTCTCAACCCAAAGATACTGG - Intergenic
1173165897 20:40687329-40687351 GGCTCTCAGCCCTGAGACACAGG - Exonic
1174925871 20:54759363-54759385 AGGTCGCATCCCAGAGACACTGG - Intergenic
1175686937 20:61038092-61038114 CTGTCACAGCCCTGAGACACAGG - Intergenic
1177354725 21:19994167-19994189 AGGTCTCACCCCAGACACACAGG - Intergenic
1178826873 21:36024626-36024648 CCCTCTCAGCCTTGAGAGACAGG - Intergenic
1179156352 21:38854256-38854278 AGGTCACAGCCCAGGGACACAGG + Intergenic
1179494745 21:41764434-41764456 CCCTCTCACCCCTGACACACGGG - Intronic
1179791383 21:43757757-43757779 CCGTTGCAGCCCAGAGCCACTGG + Exonic
1179882950 21:44300898-44300920 ACATGTCAGGCCAGAGACACTGG - Intronic
1179953672 21:44725956-44725978 CCATCTCAGCCCAGTGAAAATGG + Intergenic
1180945203 22:19688796-19688818 CCGCCTCAGCCCACAGCCCCGGG + Intergenic
1180997336 22:19972035-19972057 CCCTCTCAGCCCAGACACAGGGG + Intronic
1181164984 22:20978411-20978433 CCATCTGAGCCCAGAGACGTGGG + Intronic
1181285433 22:21748538-21748560 AGGTCACAGCCCAGGGACACAGG + Intergenic
1181350246 22:22250126-22250148 CCGCCTGAGCACAGAGCCACAGG + Intergenic
1181974619 22:26720155-26720177 CAGTCCCAGCCCAGGGACTCTGG + Intergenic
1182473315 22:30561722-30561744 CAGGCTCAGCCCACAGAGACGGG - Intronic
1183310701 22:37108088-37108110 CCGTCGCACCCCAAGGACACTGG + Intronic
1183417507 22:37691001-37691023 GCAACTCAGCTCAGAGACACAGG - Intronic
1183489085 22:38107293-38107315 TCCTCTCAGCCTAGAGCCACCGG - Intronic
1184674338 22:46032297-46032319 CCCACTCAGCCCAGTCACACAGG - Intergenic
1184731064 22:46371353-46371375 CAGTCTGAGGCCAGAGGCACTGG - Intronic
1184971248 22:48022034-48022056 CCCTCTCTGCCAAGAGCCACAGG + Intergenic
1185104514 22:48859674-48859696 CCCTCTCTGCACAGAGACACCGG + Intergenic
955093664 3:55776007-55776029 CTGTCTCAGCTCAGTGAGACTGG - Intronic
955240055 3:57170118-57170140 CCTGCACAGCCCAGAGACCCAGG + Intronic
959479427 3:106853574-106853596 CTCTCTCAGCCAAGAGGCACAGG - Intergenic
962852664 3:139319505-139319527 CCATCTCAGCCCAGATAGGCAGG - Intronic
964013701 3:151921236-151921258 AAGTCACAGCCCACAGACACAGG - Intergenic
965037634 3:163462176-163462198 AGGTCACAGCTCAGAGACACAGG + Intergenic
967098514 3:186196829-186196851 CCGACTCACCCCAGAGTCCCTGG - Intronic
967956743 3:194883243-194883265 CCTTCTCCACCCAGAGTCACTGG + Intergenic
970779602 4:19720233-19720255 TCTTCTCAGCCCAGTGACATGGG - Intergenic
971520355 4:27541833-27541855 CTGTCTCTGCCAAGAGACTCTGG + Intergenic
973613556 4:52658895-52658917 CCGTCTCAGCCCCGGGACCTCGG - Intronic
975543705 4:75539845-75539867 CCATCCCATCCCAGAAACACAGG + Intronic
977883824 4:102236040-102236062 TCGGCTCAGCCCAGAAGCACAGG - Intergenic
978369085 4:108012502-108012524 CCGTCCCAGCCAATAGAAACCGG - Intronic
979716309 4:123842965-123842987 AGGTCACAGCCCAGAGGCACAGG + Intergenic
981521150 4:145663703-145663725 AAGTCACAGCCCAGAAACACAGG + Intergenic
984483022 4:180330235-180330257 CCTGCTCAGCCCAGAGACTATGG - Intergenic
986277239 5:6287253-6287275 AGGTCACAGCCCACAGACACAGG + Intergenic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
986609084 5:9549020-9549042 CCATCTCAGACCAGAGGAACAGG + Intergenic
987404626 5:17512259-17512281 CAGGCTCAGCCCAGTGACAAGGG - Intergenic
991647373 5:68814835-68814857 AGGTCACAGCCCAAAGACACAGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994770180 5:103971978-103972000 CATTCACAGCCCAGAGGCACAGG + Intergenic
995321304 5:110837360-110837382 AGGTCACAGCCCAGGGACACAGG - Intergenic
999722740 5:154411041-154411063 TCCTCTCAGCTCAGAGACCCAGG - Intronic
1005186683 6:23170499-23170521 AGGTCACAGCCCTGAGACACAGG + Intergenic
1005476813 6:26216013-26216035 GCGTGTCATCCCAGAGACTCGGG - Intergenic
1008602779 6:53112091-53112113 CCCTTTCAGGCAAGAGACACAGG - Intergenic
1011629583 6:89311112-89311134 CGGTCACTGCCCAGAGACCCAGG - Intronic
1013355154 6:109339902-109339924 ACCTCTCACCCCAGAGACACTGG + Intergenic
1013836884 6:114343497-114343519 CCCCCTCACCCCAGAGAGACCGG - Intergenic
1014971274 6:127818240-127818262 AGGTCACAGCCTAGAGACACAGG + Intronic
1017664223 6:156703700-156703722 CAGTGTCTGCCCAGGGACACAGG - Intergenic
1017956944 6:159186601-159186623 CAGGCAGAGCCCAGAGACACAGG + Intronic
1019626963 7:2020643-2020665 TCGTCTCTGCCCACAGCCACCGG - Intronic
1020129114 7:5549482-5549504 CAGTTACAGCCCAGAGACCCAGG - Intronic
1020512752 7:9079504-9079526 ACTGCTCAGCCCAGAGATACTGG - Intergenic
1021179301 7:17487647-17487669 CCGTTTCAGCCCAGATTCAAAGG + Intergenic
1022221112 7:28314736-28314758 GCGTCTCAGTAAAGAGACACTGG - Intronic
1025158156 7:56629079-56629101 CCTGCTAAGCCCACAGACACTGG - Intergenic
1025819061 7:64946448-64946470 CCTTCCCAGCCCAGGGGCACAGG - Intergenic
1026534677 7:71229899-71229921 CTGGCTCAGTCCACAGACACAGG - Intronic
1026712191 7:72752043-72752065 CCCTCTCTACCCAGAGATACTGG - Intronic
1028317269 7:89419139-89419161 AGGTCACAGCTCAGAGACACAGG - Intergenic
1028653010 7:93171380-93171402 AGGTCACAGCACAGAGACACAGG + Intergenic
1034622010 7:152463849-152463871 CCGCCTCAGCCCAGAGGACCCGG - Intergenic
1036093923 8:5702515-5702537 ACATCACAGCCCAGAGACACTGG - Intergenic
1036720652 8:11172081-11172103 CAGTCTCAGGCCAGATACAGTGG + Intronic
1037679597 8:21085677-21085699 CCTTCCCAGCTCAGAGAAACAGG - Intergenic
1040449238 8:47527356-47527378 AGATCTCAGCCCAGAGGCACAGG + Intronic
1040953111 8:52955451-52955473 TCGGCTCAGCCCAGAAGCACAGG - Intergenic
1042867946 8:73371968-73371990 CCCTCCCAGCCCATATACACAGG + Intergenic
1047523253 8:125611916-125611938 CAGTCCCAGCCCAGAGAAACAGG - Intergenic
1048141992 8:131803719-131803741 CAGTCTGAGCACTGAGACACAGG - Intergenic
1049536628 8:143185626-143185648 CCGGCTCAGCCCCGAGGGACAGG - Intergenic
1049583643 8:143423380-143423402 CCGGCTCAGCCCACAGCCTCGGG + Intronic
1049593913 8:143474826-143474848 CCCTCCCAGCCCAGGGAAACAGG - Intronic
1049749486 8:144276547-144276569 CCGTGTCAGCCCAGGGACAGAGG - Intronic
1053820189 9:41958577-41958599 AGGTCACAGCCCAGAGGCACAGG - Intronic
1054110463 9:61102276-61102298 AGGTCACAGCCCAGAGGCACAGG - Intergenic
1054610394 9:67228849-67228871 AGGTCACAGCCCAGAGGCACAGG + Intergenic
1054735893 9:68749432-68749454 CAGTTTCAGCCCAGTGACATTGG + Intronic
1055255479 9:74365043-74365065 CCGTCTGAACACATAGACACAGG - Intergenic
1056942378 9:90966564-90966586 CCGTCACAGGCCAGAGACCAGGG - Intergenic
1057302226 9:93893641-93893663 CAGGCTCAGCCCAGAGGCACTGG + Intergenic
1059281773 9:113140504-113140526 CAGTCTAATCTCAGAGACACTGG + Intergenic
1060483258 9:124030292-124030314 CCCTCTCCTGCCAGAGACACTGG + Intronic
1060541487 9:124433474-124433496 TCGGCTTAGCCCAGAGAGACGGG + Intergenic
1060799081 9:126532316-126532338 CCCTCCCAGCCCAGAGAAGCGGG + Intergenic
1061281244 9:129598588-129598610 CCCTCTCACCCCAGAGGCAGTGG - Intergenic
1062310550 9:135933553-135933575 CCCACTCAGCCCACAGGCACAGG + Intronic
1185669892 X:1799551-1799573 ACGTCTCAGCCCAGAGAGAAAGG + Intergenic
1186578479 X:10791526-10791548 ACGTCTCAGCCCAGATAAAAGGG + Intronic
1190043666 X:47094020-47094042 CAGTCTCAGCCCAGCTACTCGGG - Intergenic
1192210770 X:69126427-69126449 TCACCTCAGCCCTGAGACACAGG + Intergenic
1192839574 X:74840102-74840124 CCGTCTCACCCCAGACAGAATGG - Intronic
1193187670 X:78532183-78532205 TGGTCTCAGCCCACAGACTCCGG + Intergenic
1194105617 X:89763198-89763220 AGGTCACAGCCCAGGGACACAGG - Intergenic
1196853414 X:119960800-119960822 AGGTCACAGCCCAGGGACACAGG - Intergenic
1196858893 X:120008891-120008913 AGGTCACAGCCCAGGGACACAGG + Intergenic
1200045892 X:153400937-153400959 CCCTCTCCGCCCAGGGACCCAGG + Intergenic
1200062463 X:153489682-153489704 AGGTCTCAGGCCGGAGACACAGG - Intronic
1200457580 Y:3411023-3411045 AGGTCACAGCCCAGGGACACAGG - Intergenic