ID: 1140414447

View in Genome Browser
Species Human (GRCh38)
Location 16:74763905-74763927
Sequence CAGGCAAGCAAATTTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140414447_1140414451 15 Left 1140414447 16:74763905-74763927 CCACCTTCAAATTTGCTTGCCTG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 1140414451 16:74763943-74763965 TACTTTGCAATATACCATCAAGG 0: 1
1: 0
2: 0
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140414447 Original CRISPR CAGGCAAGCAAATTTGAAGG TGG (reversed) Intronic
904422277 1:30402024-30402046 GAAGCAAGCAAACTTGAGGGAGG - Intergenic
905922059 1:41726368-41726390 CAGGCAAGCAGGCATGAAGGGGG + Intronic
906590234 1:47018079-47018101 CAGGCAAGCAAGAATGAATGGGG - Intergenic
909933090 1:81520620-81520642 CAGGCAAGAGAGTCTGAAGGAGG - Intronic
910591672 1:88933063-88933085 CATGGAAGCAGATTTAAAGGAGG - Intergenic
911462674 1:98210653-98210675 CAAGCCAGCAAATTTGGAGTGGG - Intergenic
912030496 1:105236556-105236578 CAGGAAAGAAAACTAGAAGGTGG + Intergenic
912505881 1:110155772-110155794 CTTGCAAGCAAAATAGAAGGTGG - Intronic
914355742 1:146882684-146882706 CAGGCCTGCATGTTTGAAGGAGG - Intergenic
916692904 1:167208361-167208383 CAGGCACTGAAATTTGAATGTGG - Intergenic
917125617 1:171684949-171684971 CAAGCAAGCAAGAGTGAAGGGGG + Intergenic
919345315 1:196368782-196368804 CAGGCTCACAAATGTGAAGGAGG - Intronic
920274415 1:204793330-204793352 CAGGCATGCAAAATGTAAGGGGG + Intergenic
921108092 1:212003460-212003482 CAGGCAAGCAAATATTGAGAGGG + Intronic
921138436 1:212284081-212284103 CCGCCCAGCAAATCTGAAGGAGG + Intergenic
924099808 1:240591584-240591606 AAGGCCAGAAAAGTTGAAGGTGG - Intronic
1063704326 10:8416179-8416201 CAGGCAATTAAATTTGAGAGAGG - Intergenic
1064792744 10:18976570-18976592 AAGTCAAGCAAATTTGAAATAGG - Intergenic
1065935573 10:30517804-30517826 GAGGGAAGCAATTTTGGAGGTGG - Intergenic
1066631755 10:37465286-37465308 CGGTCAAGCAAAGTTGAATGGGG - Intergenic
1066674070 10:37870208-37870230 CAGGCAAATAAATGTGAAGTTGG - Intergenic
1069876418 10:71566036-71566058 CAGGAAATAAAATGTGAAGGGGG + Intronic
1070434106 10:76371753-76371775 CAGCCAAGCAAATTTGATCCTGG - Intronic
1070842368 10:79496150-79496172 CAGGCAGGCAACTTGGAAGGTGG + Intergenic
1071207024 10:83293078-83293100 AAGACAATCAAATTTAAAGGTGG + Intergenic
1072300778 10:94059608-94059630 CAGGCAAGCACATGGGAAGTGGG + Intronic
1073250817 10:102119574-102119596 CAGGCAGGAAAAGTTGAAGGTGG + Intronic
1073277338 10:102323811-102323833 CAGGAAAACAAATGTGAAGATGG - Intronic
1074209528 10:111317131-111317153 AAGGAAAGCAAATTTGCTGGAGG - Intergenic
1074270500 10:111949069-111949091 CACACAAGCAAGTTTGATGGAGG + Intergenic
1076190318 10:128478794-128478816 AAGGCCAGCAAATTGGATGGAGG + Intergenic
1076321101 10:129582071-129582093 CTTGTAAGCAAATGTGAAGGAGG - Intronic
1079191913 11:18285436-18285458 CAGGAAAGCAAGTGTGAATGAGG + Exonic
1079304933 11:19313715-19313737 CAGGGAAGCAAATTAAAAAGCGG + Intergenic
1079795770 11:24800795-24800817 AGGGAAAGCAAATGTGAAGGAGG - Intronic
1079950959 11:26803806-26803828 CAGGCAAGAAACATTAAAGGTGG - Intergenic
1080776166 11:35388756-35388778 CTGGGAAACAAATGTGAAGGAGG - Intronic
1085158162 11:74315114-74315136 CAATCAAGAAAATTTGAAGAAGG - Intergenic
1085885854 11:80520925-80520947 CTGCCAAGCAAATCTGGAGGAGG + Intergenic
1087769542 11:102192908-102192930 CAGGCAAACAAATCTGATGGGGG + Intronic
1088330131 11:108642743-108642765 AAGGCAAGACAACTTGAAGGGGG - Intergenic
1088447266 11:109945472-109945494 TAGGGAAGCAAAGTTGAGGGTGG - Intergenic
1089126770 11:116181680-116181702 CAGACAAGCAAATCTGCAGAGGG + Intergenic
1089750140 11:120645753-120645775 CAGGCAAGGGAACGTGAAGGCGG - Intronic
1089821358 11:121229990-121230012 CAGCCAGGCAAATTTGCATGTGG + Intergenic
1090101142 11:123797990-123798012 CAGGTAAGCAGTTTTAAAGGTGG + Intergenic
1090595916 11:128321365-128321387 CAGGCCACCAATTTTGTAGGTGG + Intergenic
1091596936 12:1884659-1884681 TAGGAAAGCAGATTTGAATGGGG + Intronic
1093508042 12:19892203-19892225 CAGGGAAGCAATTGAGAAGGAGG + Intergenic
1094791814 12:33924108-33924130 CAGGAAAGCAAACTTTAGGGGGG - Intergenic
1095632200 12:44391553-44391575 CAGGCATTCAGATTTGAAGGAGG + Intergenic
1096122723 12:49098663-49098685 CAGGTAAGAATATTTAAAGGTGG - Intronic
1097468720 12:59961051-59961073 CAGGAAAGCAATTTAGAAAGAGG + Intergenic
1097648471 12:62264269-62264291 CAGGCCAGAAATTTTGCAGGTGG - Intronic
1098710401 12:73751260-73751282 AAGGCAGGAAAATTTGAAGCAGG + Intergenic
1100603485 12:96132245-96132267 GAGGCAAGCAAAGGTGAAGCTGG - Intergenic
1104222474 12:126798288-126798310 CAGGCCAGGAAATTTAAATGTGG - Intergenic
1105730816 13:23213774-23213796 AAGGCAAGCAAAGTGGAATGGGG - Intronic
1106060811 13:26289536-26289558 CAAACAAGCAAATTTCAAGATGG - Intronic
1108700512 13:52940288-52940310 AAGGAAAGCCATTTTGAAGGAGG + Intergenic
1109947196 13:69451575-69451597 CAGGAAAGAAATATTGAAGGAGG + Intergenic
1110141142 13:72131028-72131050 CATTCAAGCAGACTTGAAGGAGG + Intergenic
1110238457 13:73241071-73241093 AAGGCAAGCAAATTTGGTGGGGG + Intergenic
1110385378 13:74904777-74904799 CAGGCAAGCGAGTGAGAAGGGGG - Intergenic
1111755784 13:92393804-92393826 CAGGCAAACACATTTCATGGGGG - Intronic
1114356010 14:21909262-21909284 CAGGAAAGCAAATTCCAGGGTGG - Intergenic
1114656642 14:24319659-24319681 CAGAAAAGCAAAGTGGAAGGAGG + Intronic
1115573202 14:34686479-34686501 CAGAGAAGCAAGTTTGGAGGAGG + Intergenic
1115853626 14:37606639-37606661 TAGGGAAAAAAATTTGAAGGTGG - Intronic
1115863329 14:37713570-37713592 CAGGAAAGCACATTAGAAGGAGG + Intronic
1116922193 14:50590494-50590516 CAGGGAAGCAAATTTGGAGAAGG - Intronic
1120047505 14:79824521-79824543 CAGAAAAGCAATTTTGGAGGAGG + Intronic
1121951518 14:98175083-98175105 CAGGACAGCAAATTTGGAAGAGG - Intergenic
1126274109 15:46856082-46856104 CAGGCAAGCAATTATGAAGGTGG - Intergenic
1126666492 15:51080128-51080150 AAGAGAAGCAAATTGGAAGGTGG - Intronic
1132058562 15:98671153-98671175 CAGACATGCAGATTTGGAGGGGG - Intronic
1133045927 16:3088275-3088297 CAGGAAAGGACATTTCAAGGAGG - Intergenic
1135181142 16:20275753-20275775 CAAGCAAGCAGATTAGAAGAGGG - Intergenic
1137754009 16:50887269-50887291 AAGGCAAGCATATTTGGAAGAGG + Intergenic
1138599133 16:58044890-58044912 CAGGGAAGCAAATGAGAAGAAGG + Intronic
1139555701 16:67708565-67708587 CTGGCAAGCAAATTTAATGATGG + Intronic
1140414447 16:74763905-74763927 CAGGCAAGCAAATTTGAAGGTGG - Intronic
1145934615 17:28707560-28707582 CAGGCAAGCAAAGTTGATGAGGG - Intronic
1148610543 17:48961749-48961771 CAGTCAAGCTAATAGGAAGGAGG - Exonic
1149220456 17:54411104-54411126 TAGGCAAGGAAATCTGAAGATGG + Intergenic
1149705563 17:58691761-58691783 AAGGCAAGCAGTTTAGAAGGTGG - Intronic
1150345070 17:64398269-64398291 CAGCCAAGCAGAATTGAAGGAGG + Intronic
1151336683 17:73444110-73444132 CAGGCAGGCAAATCTCCAGGAGG - Intronic
1152302593 17:79503964-79503986 CAGTCAAGGAAATGGGAAGGTGG + Intronic
1153985072 18:10344108-10344130 TGGCAAAGCAAATTTGAAGGGGG + Intergenic
1156220044 18:35041764-35041786 CAGGCATGCATTTGTGAAGGCGG + Intronic
1156392223 18:36660964-36660986 AAGACAAGCAAATGTAAAGGAGG - Intronic
1157877563 18:51287806-51287828 CAGGCAGGGAGATTTGGAGGGGG + Intergenic
1158778820 18:60621650-60621672 CAGGCGTTCAAATTTGAGGGGGG - Intergenic
1160162453 18:76484003-76484025 CATCCAAGCAAAGCTGAAGGGGG + Intronic
1163157163 19:15445820-15445842 CAGGCAGGGAAGTTTGGAGGTGG + Intronic
1164895632 19:31874821-31874843 AAAGCAAGCAAATTTGAATAAGG + Intergenic
1167340566 19:48913476-48913498 CAGCCAAGCCCAGTTGAAGGAGG + Exonic
926014581 2:9438377-9438399 CTGGCAACCCAATTTGATGGTGG - Intronic
926624143 2:15076396-15076418 TAGTCATGCTAATTTGAAGGAGG + Intergenic
927921359 2:26974416-26974438 CAGAAAAGCAAATGTGAAGTTGG + Intronic
929160077 2:38822882-38822904 CATACAAGCAAATTTTTAGGGGG + Intronic
929545066 2:42850409-42850431 CAGGCAGGCTAATTTGAACCTGG + Intergenic
929589683 2:43136684-43136706 GATGGGAGCAAATTTGAAGGAGG + Intergenic
929642429 2:43595450-43595472 AAGGTAAGCAAGTTTGCAGGAGG + Intronic
929892571 2:45930555-45930577 CAGGCATTCCAATTGGAAGGTGG - Intronic
930479101 2:51924733-51924755 AAGGCAAGCAAATCTCAAGCAGG - Intergenic
931578861 2:63751876-63751898 GATGGAAGCAATTTTGAAGGTGG - Intronic
936523831 2:113229490-113229512 AAGTCAAACAAATTAGAAGGTGG - Intronic
937631050 2:124101509-124101531 AAGGCAGGCATATTTGAAGGTGG + Intronic
938771103 2:134501652-134501674 CAGGCTAGCAAGTCTGATGGAGG + Intronic
939741296 2:145910561-145910583 AAGGAAAGGAAATTGGAAGGAGG - Intergenic
941505450 2:166338195-166338217 GAGACAAGCAATTTTGAAGCAGG - Intronic
941605810 2:167595089-167595111 CAGGAAAGCAAATGTGGAGCTGG + Intergenic
942195190 2:173510446-173510468 CATGCAAGGACATTTGAAAGTGG + Intergenic
942800122 2:179865185-179865207 CAAGAAAGCAAATTTATAGGAGG - Intergenic
943140994 2:183980986-183981008 CAGGGAATTAAATTTGAAAGAGG + Intergenic
946077152 2:217083861-217083883 GAGGCAAGCAATTCCGAAGGAGG + Intergenic
1169868355 20:10224670-10224692 AAGGCAAGCAATTCTGAGGGGGG - Intronic
1170024551 20:11874593-11874615 CAGGAATGCAAATTAGAATGGGG - Intergenic
1172168420 20:32913421-32913443 AAGGCGAGGAAATTTGGAGGTGG - Intronic
1173011297 20:39185030-39185052 CAGGCAAGGAAATGAGAAGAAGG + Intergenic
1174044402 20:47723274-47723296 CATGCAAGATAATTTCAAGGGGG + Intronic
1178378335 21:32087176-32087198 CATGAAGGCAAATTTGAGGGAGG + Intergenic
1180104755 21:45610834-45610856 CATGAAAGCTAATTTGAAGCAGG - Intergenic
1181349773 22:22246658-22246680 CAGGCAAGATAAGTTGAGGGGGG - Intergenic
1182450235 22:30415751-30415773 CCTGCCAGCAAATTGGAAGGAGG + Exonic
1182935364 22:34217030-34217052 CTAGCAAGCAAAATTTAAGGAGG - Intergenic
1184404065 22:44290119-44290141 CAGGCAGTCACATTTGAGGGTGG + Intronic
1184437964 22:44491004-44491026 CAGCTAAGAAAATCTGAAGGGGG + Intergenic
1185288807 22:50014071-50014093 CAGGCAGGCACATTTGGGGGTGG + Intergenic
949777146 3:7646141-7646163 CAGGCAAACACATTAGAAGAAGG - Intronic
950398209 3:12750289-12750311 CAGGAATGCAGATTTGAAGTTGG + Intronic
954762467 3:52886300-52886322 CAGGCAAGCAGAATGGCAGGGGG + Intronic
954876967 3:53808661-53808683 CAGGCACTCAAAGTTGAAGGAGG - Exonic
955341525 3:58129057-58129079 CATGAAAGCAAATTAGAAGGTGG - Intronic
955486969 3:59444924-59444946 CTGCCAAGACAATTTGAAGGTGG + Intergenic
956263689 3:67374004-67374026 CAGTCAACCCAATTTGGAGGAGG - Intronic
957562831 3:81845777-81845799 CAGGCAAGCATTTTTCAATGGGG + Intergenic
957716561 3:83935989-83936011 GAGGCCAGCAAATTTAAATGGGG + Intergenic
958546304 3:95555936-95555958 GAGGGAAGCAGAATTGAAGGTGG + Intergenic
958636875 3:96755970-96755992 CAGGAAAGAGAATTTGAAAGAGG + Intergenic
961584263 3:127909398-127909420 CAGGTAAGCAAAAAGGAAGGTGG - Intergenic
961700791 3:128743141-128743163 CAGGCCAGCAGATGTGGAGGGGG - Intronic
961709922 3:128820308-128820330 CAGGCAAGCAAGTTTAAATAAGG - Intergenic
961850889 3:129817191-129817213 AAGGCAAGCACATTTGAATCAGG + Intronic
961859913 3:129907979-129908001 CAAGCAAGCAAGCTTTAAGGTGG - Intergenic
961972077 3:130978844-130978866 CAGGCAAACACCTTTGAAGGTGG - Intronic
963624457 3:147653622-147653644 AATGCAAGCATATTTGAAAGTGG - Intergenic
965986428 3:174759331-174759353 CAGGCAAACAAATTTGTATCTGG - Intronic
966549080 3:181184046-181184068 CATGCAAGCCAGTTTGAAGTGGG + Intergenic
969166456 4:5320032-5320054 CAGGAAAGCACACTTGCAGGAGG + Intronic
971308965 4:25507341-25507363 CAGTGAAGGAAATGTGAAGGTGG + Intergenic
972707598 4:41560510-41560532 GAAGCAAGCACATTTGAGGGAGG - Intronic
972812467 4:42605606-42605628 GCGTCAAGCAGATTTGAAGGAGG - Intronic
976044621 4:80930571-80930593 CAAGCAAGCAATTTTGCAGCTGG - Intronic
976513347 4:85935656-85935678 CAGGGAAACAGATTTGAAGATGG - Intronic
976633313 4:87261880-87261902 CATGCCAGTACATTTGAAGGTGG - Intergenic
976738188 4:88332187-88332209 AAGGCAAGACAACTTGAAGGGGG + Intergenic
977932665 4:102765511-102765533 AAGGTAAGAAAATTTGAAGTGGG + Intergenic
979679308 4:123442475-123442497 CAGCCAAGCAAGTTTAAAGGTGG - Intergenic
981153728 4:141409366-141409388 GAGGCAAGCAAAGGTGAAAGGGG + Intergenic
982503663 4:156191998-156192020 CAGGTAAGCAAAGGTGATGGAGG + Intergenic
982526740 4:156488598-156488620 CTAGAAAGCAAAGTTGAAGGAGG - Intergenic
987846849 5:23297617-23297639 GTGGCAGGCAAATTTGAAGGTGG + Intergenic
991231300 5:64335701-64335723 CAGCAAAACAAATTGGAAGGGGG - Intronic
992290371 5:75273291-75273313 CAGGCAAGCATATGGGAAAGAGG - Intergenic
992480556 5:77147397-77147419 CTGGCAAGGAAATTTAAAGCAGG + Intergenic
993316632 5:86415205-86415227 CAGGCAAAGAAATATGATGGAGG + Intergenic
993656683 5:90586345-90586367 CAATCAAGGAAATTTGAAGGTGG - Intronic
996338780 5:122413236-122413258 AAAGCAAGCAAAGTTGAAGCTGG - Intronic
997759318 5:136429642-136429664 GATGCAAGCAATTTTGGAGGTGG + Intergenic
998415103 5:141940492-141940514 AAGGCAAGAAGATTTGAGGGGGG + Exonic
1000583181 5:163058985-163059007 CAGCAAAGCAAATATGAAGCTGG - Intergenic
1004644350 6:17544919-17544941 TACGCATGCAAATTTTAAGGAGG + Intronic
1005616285 6:27576334-27576356 CAGGTAAGGGAATTTGAAAGTGG - Intergenic
1005647821 6:27858101-27858123 CAGGCTAGCAAATATGGAGTAGG - Intronic
1006073288 6:31512390-31512412 CAGACAATAAAATTTCAAGGAGG - Intergenic
1006799662 6:36751914-36751936 GAGGGAAGCAATTTTGATGGGGG + Intronic
1010377148 6:75184114-75184136 ATGGCAATCAAATTTGAAGGAGG + Exonic
1010517777 6:76794222-76794244 CAGGCAAACAAGTCTGGAGGGGG - Intergenic
1011488379 6:87866697-87866719 CAGGCAAGGATGTTTAAAGGCGG + Intergenic
1011841292 6:91502705-91502727 CAGGCAATTAAATTTGAATAAGG + Intergenic
1012982311 6:105843529-105843551 CAGGCAAGCAAAGTGCAAGGTGG + Intergenic
1014463311 6:121725338-121725360 CAGGCAAGCAATTATAAAGATGG - Intergenic
1014866154 6:126532891-126532913 CAAGCAGGGACATTTGAAGGCGG - Intergenic
1015234517 6:130955247-130955269 CAGGAAGACAAATTAGAAGGAGG - Exonic
1015439025 6:133225854-133225876 CAAGCAAGCAACTTTAAAAGGGG + Intergenic
1017317612 6:153050422-153050444 TTGGCAAACAAATTTGCAGGCGG + Intronic
1018152219 6:160951123-160951145 GAGGCATGCAAAGGTGAAGGAGG + Intergenic
1021912012 7:25395925-25395947 CAGGCTAGAAAATTTCAAGATGG + Intergenic
1022608850 7:31847913-31847935 CAGGGAAGGAACTTTGAAGTTGG - Intronic
1024624244 7:51190703-51190725 CAGGCAAGTCAAGTTGAAGTAGG - Intronic
1028164489 7:87522208-87522230 CATGGAAGCAATTTTGGAGGTGG + Intronic
1028419656 7:90618597-90618619 CAGGCAAGGGAAGATGAAGGGGG + Intronic
1029248490 7:99219421-99219443 CAGGCAATAAGATTTGATGGAGG + Intergenic
1030523917 7:110630652-110630674 CAGGCCCGCAAAGTTGAAGAGGG + Intergenic
1030917311 7:115331299-115331321 CACCAAAGCAAATTTCAAGGTGG + Intergenic
1031175649 7:118345494-118345516 CAGCTAATCAAATTTGAAAGTGG - Intergenic
1031672560 7:124567903-124567925 CAGGGGAGGAAATTAGAAGGAGG + Intergenic
1032479173 7:132232851-132232873 CAGGCAAACAAATTTCAATTTGG + Intronic
1036012638 8:4744292-4744314 CAGGAAAGCAAAATGGAAGAAGG - Intronic
1037859769 8:22396881-22396903 CAGGCAAGGAAAAAGGAAGGAGG - Intronic
1042535498 8:69854649-69854671 CTGGCAAGGAAAGTAGAAGGAGG - Intergenic
1042717756 8:71793449-71793471 CAGGTATTCAAATTTGAATGTGG - Intergenic
1045667857 8:104509979-104510001 CAGGCAAGGAAATTTCAAACTGG + Intronic
1045936627 8:107687000-107687022 CAGACAAGAAATTTAGAAGGAGG - Intergenic
1046619281 8:116511345-116511367 CATTCAATCAAATATGAAGGAGG + Intergenic
1047021563 8:120780236-120780258 GAGGCAAGCCAATTTGGTGGTGG - Intronic
1047234352 8:123026514-123026536 CAGGCAGGAAAATGTGCAGGTGG + Intronic
1050841776 9:10158690-10158712 GTGGCAGGCAAATTTGGAGGAGG - Intronic
1051300087 9:15640403-15640425 AAGGCATTCTAATTTGAAGGTGG - Intronic
1054937988 9:70709726-70709748 CTGGAAATCAAGTTTGAAGGTGG - Intronic
1054939679 9:70727719-70727741 CTGGAAATCAAGTTTGAAGGTGG - Intronic
1058607538 9:106739257-106739279 CAGGCAAGCAAAATGTAATGGGG + Intergenic
1060131997 9:121110725-121110747 TAGGAGAGCAAATTTGAATGTGG + Intronic
1060795937 9:126513357-126513379 AAGGTAAGCAAATGTCAAGGGGG + Intergenic
1061836668 9:133334049-133334071 CAGGCTACAAAATTTGGAGGAGG - Intronic
1062228616 9:135468274-135468296 CAGACAAACAAATATGAATGAGG - Intergenic
1186887111 X:13924829-13924851 CAGGCAAGCAAAATTAATTGTGG + Intronic
1189656821 X:43253223-43253245 CAGCCAAGCAAATTTGAATTGGG - Intergenic
1190151861 X:47956061-47956083 CTGGGAAGCAAATTTGGAGGCGG + Intronic
1190153773 X:47970701-47970723 CATGAAAACAAATGTGAAGGAGG + Intronic
1190160841 X:48030399-48030421 CCAGGAAGCAAATTTGGAGGCGG - Intronic
1190618189 X:52260146-52260168 CAGTCAAGGAAATGTGTAGGAGG - Intergenic
1190693474 X:52931997-52932019 CATGCAAGGAAATGTGTAGGAGG - Intronic
1190951202 X:55144976-55144998 GAGCCAACCAAATTTGAATGGGG - Intronic
1193613484 X:83659889-83659911 TAGGCAAACAACTTTGAGGGAGG + Intergenic
1196004785 X:110824017-110824039 CAGGCAAGAAATTGTGAAAGAGG - Intergenic
1196805700 X:119583724-119583746 CATGTAAACAATTTTGAAGGAGG + Exonic
1199045640 X:143168073-143168095 CAGGGAAACATATTTGAAAGGGG - Intergenic
1199176539 X:144793989-144794011 CAGGCATGCAATTTGAAAGGAGG - Intergenic